Description :
From Genome Similarity Track
Location :
Scaffold_3574:126- 2565
Transcript NameFunction/comments
Pytiw_DAOMBR242034snap_masked-piw_contig_3574-abinit-gene-0.3Conserved gene of unknown function

Sequence
2439 bases(100 bases per row)
GACAGATAACTCACCGGCAGGAAGCGGGTGCGACACGAAGGACGTCAAATTATCATCAATAGTGATTCAGCACATGGATTCACCTGTCGAGATGTAGATC
TTGGCTCAAGTTGCTCGCTCCTTCCTTGCTTGCTTCCAGCATGTGCTGATTCCTTTCCACTCGTTAGGTTCTCGGCAAACTTTCACTGATCGTATTTGGA
TGTGCAGCGTCGACTATTGCTCGGTGCACCCAAGCCATTCCTCTTCAATAGGTACACACGGAGCCCCGACATGACGTGCGATCTGGCGCCTGCGGATCTC
ATCGACAACTGGCGACTCCAAACACGCGATGACCTGGAAGCGGTCGTTGTAGCAGATGCCCGTCTTGTTCGCTGAGAACATACACTGGTGATACATCACT
CCCGCACAAAAGTCGACGTGTTCCTTGCTTGGGGACTTGAGAAGATCCGCATCGCCCACAAACGTTGCTGGGCATACAGAGTAGCTGAACTGGCGCACTA
ACAGCTCAGTGGCGGCGCCATCGCTGCCCAAACACGTTGTGTTGCTGCAGATCGCTGGTGCATGGTCGCACGTCCCAAGTCTCCCGTTGCAGCACACCGG
AGCATCCAAGATCACCAAGTGAGAGAAGTCAGTGTGAGTCATCAGCCCGGGAATCTCCTGGATTTGTGCGAGAAACAGGAGCTCCAGGCGCTCCAAATTC
GTCAGTGATTCTAGCGACGGGAGCTCTTGCAGCGCGATCTGCAGTGTCAGCGACAAGCTCTTAAGGTTCGTGAATCCTTTAAATGAAGGCAGGCGCTGCA
ACGAGCTGTGGACTCCGAGATGAAGAAATGTGAGCGAGCTCGTCTTGGAGAAGAGGTCATCGGACATCTCAACGAGGTTGAGGGTGTCGGCCTTGCCTTC
GATGTTCCTGTGTCAGCAAGTCCAAGCGTGGCAAGGTCAAAAGTACATGATGAGGGATGATATCCGACAATTTGTAGCTTGGCTTGGATACTACTCACAG
GAACTCGAGCTTCTCAAGATCTTTCGCCCAGGCTGGAATCGACTCTGTCGACGTATGCATCAGGGAGCTGGAGGATCACAGTTCTCACGTAGTGGTGAGA
GATTATACCCCAAACAGCAAAGCAACACCGAAGACGTACATGTGACGCAGATCCCGACACTGGTGCAGCTCTTCAGGCAGCTCGTGGAGCTGCCGGTTGA
TCACTTCGACGACTCGCAGATCGTCCGACGCCGCGAGCAGCTTCAGTTTGGCCGTAGCGTCAGGCAAGTGTTCCCACTCCTCGTAGCTCTTTGGAGCCCT
CTTGACGTCCAGAAAAACGAGACATGGGCACAACTCGCGGTGGTTCGTGGATCGATGGGCGTAGGCGACGCATTCCGGATACTGAGTGCAGACTGACCGC
GAGAAGCTCACGCATCGGTCCGTGTATTCCAAAAGGAAGCCGCACATGGCGAGAAACGGGATGACGGCCCATTTTGGCACTAATTTCTGGGTCGTGGTGT
AGTCTTTCCCCTTGGTAATAGACCGGGAGCTCGTGTTACTGCGAATCACGGCCTGCTCCGCCGTGACCTCCAGTATCCGCTTCAGACGGTAGGCGAACGA
CAGGTTCATTCCAATGCGCAGGCAAAAGTCGAGCGCTGTGGCGATCCACAGCGCGTTGAGGTTGAGGAGGAAGAGATTGACTTGCGCTGGGTCCGCTCGC
ATGCGCGTCTGGCGCTCAAAATCTCCCGCGTTAGCTACTTCGTTGGAGATGAGGAAGACTTCGCGGTCAAACTGGAAATTGTAGTAGCTGTAGAGCAGTA
GAATGGTTGGCGCACCGACGGCGAGGATCATGTCGAATCTGTAGAAGCAAATGTAGACTTGTGAGAATTCTATCAATGCCCTTGTGGCTTCAAAAAAACA
GAGTGGGCAGCTGCACTTACACTGTGTCGACGAGGACCTCGGCAAACGCCGCCAACCGCGCGTGGTTGAGGATGACAAAGACGCACGAGAGGCAGTTGGC
GCCGACAAGCGCCGAGTACGTGTAGCATAGCACGACTGGGAACCCGGCTTCTAGCACCTGGTGCAGTGTCACGATCTGCAGCACCAAGTCCACGCCCTTG
AGAAAGAGGTTCTGTTTCAACACGACCAAGAAAATGTTAGGAGGTGGTCTCGTAGCAATGGACTAACACAAGCTCGCGTACCCATCGCTTCCGGTTCGCG
CCATGGAAGCCTGTGAGCGTGTTCCAGTTTGTCACCGCATCTTTGCCGAAGATCTTGAGGGCTGAGTTGGTCGCGAAGCTTCGGGATTCGTCGCCGAGCC
TGGCTAATGTCACGACATCACTGACTCGGTGCGCAGAGCTACCCATGACACTCCGATTCCTATCGCCGAGTGGCTCATGTAAACGACAGCAACTTTGTAG
GAGTATAATTTGGCAAGTGCGTGGAGATAGCCAAGCAGC