Description :
From Genome Similarity Track
Location :
Scaffold_2870:126- 2051
Transcript NameFunction/comments

Sequence
1925 bases(100 bases per row)
TGCACAAGAGCCGCGGAGATCGCCCACTGACTCGCGTAAACTACGATCACTGGAGTGCGATCTGCGTCGAAATGCTTCAGGATCGGTGTGGACACGATTT
TGGCCTTCAACATTGTGAACGCGATCTTCGCTCGGGCCCAGCGGTCAGCGTCTTCCGCTCGCGGGACATCGCCCCCAGTTACTTGTTCGCTGGGAATGGA
TCTGTCCTGTCGGGCAATCTCGTGGAAATCCGCTTCACGCAGTTCGTACAAGACGGCCGCATAGATCGCGAAGTCTTCGATGAAGCGACTGTAGTAGTTC
AAGCTTCCAAGGAAGGACTGCATCGATCGCAGTGTCTGCGGGAAGGGAAGGTTGCCTAACACTTCAAGATCTTTTGGGTGGGCTTCCAAACCGTCGACGG
ACACTCGGTGTCCCAAGTAGTCCACTTTTCGTCGGCCACAGAAACTTTTGACCACACTGATGGACAAATTCCACCGTTCGCAAGCATCGAGTAATGCTTC
AACCTTCTCACACAGCAAGTCCCAAGTGATCGCAGTCACCAACATGTCATCGATGTACGATCGCCTTCCCAACACTGACGGTTTCGGCTCTAGTTCCGGC
TCGCCTGAATTGAACACGTCGATTGGCTTCGACGGGTCGTGACCGGCGCGGATTCGGAGATGTCCATACAGCGCGTTATCAATCAACCGCTGGTAGATCT
GTGGCGCATTCTTCAGCCCGAAAGGCATACGCGTCCACTCGAACAATCCGAATGGCGTGATAAAAGCGGAGATTTTCCGTGCACGCTCCGTCATGGAGAC
TACCCAGAAACCACTTGCCATGTCAAGTGAGCAATACCAGAGCAGTTTGTCCAGGTCTTCCAGGAGGTCGCTAATCAGCGGCATGGGGTACACCATCAGT
CTCGTCAAACTATTCACCAGCCTGTAGTCGATACAGAGCCGGATGTCAACGCCGTTCTTCTTGATGATGATTACGATCGGAGAGGCCCACGGTGAAGTTG
ACGGCGTGATCATCTTCGCCGATAACAGGCTCTTGATCAGATCCGACAGCTTCTCACGGAACTGTGGAGCGACTTTTCGGACACGTTGTGCAACAGGAGC
TGCTCCTCCCACATCGATGTCGCAGACTGCGCCAACGGCAGCTGGTGGTAATGCGTTCCCCTTCCCGATCAGGAGATGTTTCCGTCTCCAAATTATCTGT
CGCAGCCGATCGATTTCTTCCGGGGTGTTCGACTCAGGATCGCCCACTTGAATATCCTCGATCGTGACTTCATCGGTGGTGGTCACTACTTCCGGCAAGA
TTGCCATCTGTCTCTCCACATCTTCCGCGAACAGGTCGCCGCCTTCGTGGTAACATACTTCTTCGTCATCGAGCGGTTCTGGATCAACGATCGGAGGTGT
TTCGCCCCGGGGCAAAGACTCCTTCCGGTCAGCAGTCATCTCGCTTCGTGTGGCCTGCTCAATTGGTGGAGATTCTCTCGCGTCCTGATCGCTAGTATCA
ACTTCCTGATATCTTGGAGGTCCCTCAGTTTCTGGTTTCATCTCGGCGGGTCGAGGCACGATTAGCTGTGCGACGACCGACCTCGAGGTTTCACGGTCAC
GGCGCAAGATTTTCATCGGTGTGTCATACTGAGGTCGATCTACTATGGGTCCGGCAGGAGCGAGTTCGCGTTCTTCTACCTCCACACAGTCTGTAGTGGA
CTGGAAAGCCAGATTCTGCCACTTGGCATACCTGCGCGATCCAAGTAACACGAAATCGGGAGTGCGAGGTACGCGTCCTCCTTCAAGCCACATGCCGACG
TTTGGGTATCGTCTTGCAATATTAATTTTTGATCGCTGATGTTCGTGATCTTCAGATAGCGAGTTTTCCCCAACCCAGTCACCAGACTCAGTACCCATCT
TTCTCCTCGAGTAACCCACAGCTTC