Description :
From Genome Similarity Track
Location :
Scaffold_1239:126- 1211
Sequence
1085 bases(100 bases per row)
AAATTCAAGAATTCGTTTTCTCGGAAGATAATCGTAGACCACGCCATCGACCATAACAGATTCGTGCTCTCTTTGTTTACTCTCCGCTCCTGAGATCGAG
TTTGTATTGATAAACTCATTAAATGAAGTCAATGCGCCCGAGTGAGATGCATGTTGTTCTTGTCGGAATGTGACTTTGATTGTGTCGCCCGGTGCCTGAC
TTTTAGCGTTGCCGATGTCTGCTATACGATAGACGTGATGTTTTCGAATCAGATACTCCTTTTCTTGGAGTAATTTCTTGAGAATCCTTAGTAGTTTGCC
TGGACGTATGGTATCGAAGCAGCGTTCGATATCAACTTTGACGCAATACAAAGGAACTGAATGAGAATCCGATTTGAATCGCATGAAAAATGGTCGTAGC
TTTTGCTGCACTTCCATCAAGTTGCGAACCGTTGAACCAAGAACTCGTGGTCGACGCTGAATCTCATATAGTAAAACGCGGTGAATGGAAGCGAGGCATT
TGTTGACTGATCGATTTTGGATCTTGACGTTTGGATAAGTTGATTGGCTTGTGCAATTGACCGATGACAAATTCATCAGTGGACGCAATCCTCCAGCATC
CGCTTTTGGTAGAAAGCGCAGGCGGGAGACCGGTAGACTATACGACTTGTCATGAGAAATCAAGGCCGCATCGGACTTGAAGAGAATCTTCTCTTGTCGT
AGAAGACTGCCGAAAGCATCATGAAGAGCTAAATTACTACAATCATGAATGCGTAAGCTTTGAACGGGAATAATGTGTGGTCAGCTACCTGATCGTATTC
CAAACTGGTTTTTGGAAATAGAAAAGCTCGTATCCGTTACCTTCAAACTCGGTGATGTAAAACCATTTGCGAAGAAGTGGAAAGATGATTGAGTGAACTA
TCCAGAACAAGAGATCCGCCAACAAGGTCCTTCGTTTTTCAAGCTCGTTTGGTGGGCTACATGCAAGAATCCCAGCAATCATTGTACAGAAAAAATATTC
TGTGATTATCGACGCTACCAAGATGTTGTAGATTGTAGATTCATCCAAGTGATCGTTTTGATTCGGAAAAGGTTTGCCCACTGTG