Description :
From Genome Similarity Track
Location :
Scaffold_18:125997- 128926
Transcript NameFunction/comments
Phyca_LT15347245structural maintenance of chromosomes protein 5 puta
Phyca_LT1534506141conserved unknown protein

Sequence
2929 bases(100 bases per row)
tactctacatgaagttaaatgccgactgcccaccactgaggcgtggaccatcagcagcaccaggaggcggagctgcacctgtagccattcctgcgttccg
cggagagttggcaatggcaaaaaggtcctttccgaaatggcccaatgccttgttgtgctcatcttgttggggctgctggtaatattgctgctgttgctgt
tgagggtaggatgattctgacgatgtagagtttccaagtgtatcaaaaccgtcaagcagctgcaatgaaaacaaggaaattgttgtttggtaaagcgttt
ctgaaaagaaaaacaaatacaaacgtaccgaaagttcttgcgggggtgccggggccggtggaggctgtgaacgcacaggtgagccaagaaggtccgcagt
accctgtacaccatgatcgactggaccagcagacgactcaagactaagtgatccaaaacccagaaggtctacttcttgctgtggttgcttcgaaagactc
ctggtggggctactgcgctgtgctcgagatgatcccgagcgtttggcaattggctgtggagcttgatcactttcgtctgcataaccaagcgcgcgtaaaa
tctgcaacgccttggaaacaacacttggcttcgcatcctttcttaactgtagaatatgagtaattgtaccttagttagcaatgtgttgaatgatagtaca
ttgcaaaaaaacgaacctcctcgatgacttccacattggcctcgaagaactcctggtaaggtgcaccacctggagaatcgagcagcgctagtaccacgtg
tagacccttcaagcggacctgccaagtatcgtcctcaagtttatcgagcaagatgtcgccaatagtttgtgcatccaacgtctgcgcaagatcgacaaaa
cgtttcaatccatctgcaggcggcgcacgtgaaagccccgcaggcgcacataggccgtcaatcatcgtccgctcatagtccctatacgcaataacttagt
agtgaggaaactgtaatcctatcaacatgctcagatacaatttcgtacctgctggtatcgcccccaccagctccctgatgagcgtttggctggtagtagc
cgtggtcaattacttgcgggccagcgcgcagctcgtcattatcagccaaggatgaagccattgacttatccatattgcggcggtcccatttctccagcgc
agctgtacccatctttttcaatacctccgctttcttgccgagagccgtagtcggcgcatcactgagcggctgtccgtttacgggaagacccatactaccg
atacggtgcgtactgccgctgagcatacggttactgttatcaacgtaagaccctccaggctgttgactgccaaacccgcccgattgcgaacctccatagc
ctcccggctgagaaccaccataaccgccagactgagaaccaccgaagccactagattgagaacttccaaagcctcctcgtgcactacctcccatggcatt
cgggttgtatgagtttccagcgctggccccacgaaccatattcgggttgtaagtgccgctgttgaagccgcctaatcccgatgtcgcgcccgtgttgcta
ctaccgaagcctcctgtcggcttggggaagttaagcgaatgacctaccaacactgtaggacgattgtctcgtcttgtggatggattgtagcgcggctcat
tttccgtcgcagggtctttcttttggtatcctgtactgctccaaacgccagcaccagtggtcttcgacgctaagccagagccggacgaagatgaccacga
attaaaaccacttgcctgttgctgttgctgctggggtgtgttctggccataaccactcggtggaccgttctggttgtagctattctgtccgtagccgctg
ttaccaccgcctgacggtccattatagcctccagacggagcgttgtaccctccagcagaaggcgcgttgtatccgccaccagagggcccattgtagcccc
cactagacgcaccgttgtagccgccgccatttgctccgttgtagcctcccgacggattatcctgataaggtgccggtcggctcgaggcctgtggttgccc
ccacgatccaccaacactcgcgtgctgtcgttcaggttggcctccctggttatacgctccatccgcgttgttatgaggcggtgcgttgtctccctgcggt
gcctgccagctgttcgcaccctgaggaggctgctgctgttggtgctgctgctgaggtggctcctcattacgtcgagacagaaatccatcgtttaaacaca
ccagtgcttcctgcatgcaacacaccaccaagacgagtaagcccttctacccatcacgtgatacttccaaaattcaaatgccgtccaacctgcgacgcca
ctcgaatacgacggtatttttcatctccatacaccggatccggcggtcccgaaaactctacaacgtcaatgacacatctagtgagaccttgaatagctcc
aacagttttgcatcttgtattccacgtacgcaaataggctgacagttcctgttcctcgtccctgatagcctccgtgaaagctggactgccttccctgatg
cagaactaaacaatacaccgtcaatacttcaaaacagctcaataaaataaacgcattccttcaaacccaccgaaatgatctgcagcgccttcagcttgac
agttaagttgctcttattgagccttcccaacatatagtcggcgatcttctccgcgtcgcgttcacttgacttggttgcgtctacgataattaaaaaacag
tgaaaaaatgaactatcgaggctacaacggcagtggtagctgctacttactggcaatttcccccataaggtagacaggcacagggccgtcatgcagactc
gtggcctcggccagtgtgtgccgattcat