Description :
From Genome Similarity Track
Location :
contig_30:125979- 159506
Transcript NameFunction/comments
g5290.t1hypothetical protein
g5291.t1hypothetical protein PHYSODRAFT_566381
g5292.t1hypothetical protein PHYSODRAFT_533462
g5293.t1hypothetical protein PHYSODRAFT_289190
g5294.t1hypothetical protein
g5295.t1hypothetical protein PHYSODRAFT_307593
g5296.t1DNA ligase, putative
g5297.t1conserved hypothetical protein
g5298.t1hypothetical protein

Sequence
33527 bases(100 bases per row)
CGACGAGCAGAACGCAAAGTGAAAATGTGGCAACAGAACAGTCAATCAATGAATAAATACATTCCAGCGAAGTTTCATCAACCTCATCAACTCAACCAAC
GCTGGCGCGTGGAGGCTTATCTCCATTGAGCCCCCTCGATTTCTGCAAAAACCTCCTAGCAGCTGCCTGGGCAACTGGACTCGACAGCAGTGACACACCA
GCACCGCTAGCACGGCCCTCTTCACGGTCACCTGAGCGCAAGTCGCGTAGTAGCTCTCCGAACCCGCGTCCGTAGCTTAAGTCACTCGAGAAGACGTACG
CCCGCCCCTCTCGTTCGAACAGCCTGCCCAGCGTAGAATCCACGCCTCGGGGCCGCTTCGAAAAATATATTGGCACAATCGTCTTGCCCTTGTCTTCAGC
AAACGCCAACTGGTCACTCACCAGCTCCGTCTTCACACTTCGCTCCGAAAGCACGACCAGGAAAACCGAGCTCTGCAGGATAGCATCCTTCGCTGCCAAG
ATGCGCTCCTTGGTGCTGGAGACATTAGTCATTGAATCCACCACAAACGGCAATTGATGACGACGCAGCTCCGTGCACAAGCGCGTCACAAAGTCGCGAT
GGCAATCGCCGTGCGATACGAAGATCGAGAATGTAGGACCTCCTCCAAACGTACTCCGCCTCCCACTACCGCGCACGACCACGGCATTCACTATATCATC
CAACCGACGATGCTTGAGCGTTGAAGTCCTTACTATTGGTTGCGTGTACCTACTTGCCATCGTTTGAGCAAGTTCTCGACTGCCTTCCAACCGATGCATC
TCAACCTCGTCACGCAATCCGTCAATGAGACTTCTGAGGCTAGCCTGAAACTTGTCCTCATCAATTTCAAACTTCAAACGGTCCATGGACGATGAATCCG
ACGAGGTAGAACTGTTGTCGCTAACTTCTGGTATTTTGGCATGACTGGAAGTCACGGCCTGGCCGAAAGGCACAATCTGTCGCGTGAAAACAAATACCTG
CAACTCTTCAGACATTTTGACGGCTTCACACGATATTGGCACCACCGGTACTTCGTGCTGCTTAGCAAATGCAAGCTCATCCATACACAGTATGCTCTGC
GCATACCCATTTGTGAGCATGCACACGATAGCAGAAGCGTTCTTCATCACCCCCAGCGATTCTTCTGATGCACCACCACCCTCGTTACCCACAGCATCTT
CGTGTTCATCGCGCATATACACTGTCATGAAGTTTTGTTCAATACCAGCCTTTACACGCTCAGCAAAACCGCCAAACACCGGGTCGAATGATAACACAAC
ATCGACACAACCACCTGCGATCTTGACTACGTACTGTAGTTCAGCCGACGCGCAGCACTCGATAGCCCGACGTCCATCCCCATTCAGCGCGTACAGGTCA
GCTTTACCTTCGACTAGTAGAGACAGCGCAGTCTCCTTATAACCGAGCCGCAATGCAATGTGGAGAGGAGTCTCCTCCATTTCATTTGGGACAAGTTCAC
TGACATCCGCGCCAAAACGGACAAAGAGTTCTACGCAATCTCCTCGAAGTAGACCCCCTTCCACAGCAAACGCTAGCGGGGTCATTCCGTCATGGTCCAA
TTGCAAATAGTCTGCATCCACAGCGAGGAGCTCCTCTACTGCTCCAGGATAGTTGTGGCGAGCTGCCCAGTGCAGAGGTGTCCGTCCATAACTGTCCTTA
GCATTGACATCAGCACCGTGTTTCACAAGTTCACTGATGACACGCTGTCTTCCCATCACAGCAGCCCAGTGAAGAGGCGTACGACTGTGGGCGCCTCGCT
GAAACTCGCCTAAAACATCTGGGCTAATGCCCCCGACAGCAAATGGTTCACGGCAGCAAGGTTTCCTGCAGCGGATGTTTCGTGCAGCGGGGTGAGCGCA
ACATCAGCTCCCCATTCCTCTAGCACTGCGGCCAGCTCGCGACGGCCCGATAACTGCGCTCGTTGAAGCACAGTCGTGCTGGCAGCGTTACCAGACCCCG
GAACTAACAGAATGTTGGCTCCGTGCCTGATGAGACTTTCAACGACGTCGGCTGAGTCAGCTAAGAAAATCGGGGTGACACGCATCGAACGAGAGAAAAA
GCTGGACCGCGCAATGATGTCCAAGTTGGCCCCATGCTTCACCAGGAGATCAATGACCTGCGTGTGGCCGTGCAAAGCGGCCACATGCAGAGGTGCTCCC
AGTATATGCGTCACTTTCTTCACTCGCAGCTGACACAGCTCGTACAGCAGCTCCAAATTAAACGTGGCGCCAGATATTTTATCGAGAAAGTTCGGGTTCA
GCCCTGCTTCAAGTAGCACCGAAACGACTCGAACATCGCCAGCTCGACACGCCACGTGCAGAGGGTTCTGCGTTCGATGCGAGAACATCCAACATACCAG
TGACGGCGTAGTGTACATTCGATTGAGCAGCATATCCAGCTGCACCTTGGATCCGAGTACGTGTTCAGCGCGCTCCAGCAGTTTCTCCACGGCTGCACAA
TTTCCGCTCGCTGCAGCGTCGTACAGCGCGCCACGCAGCTGCCTCTCGACCGTGCGCACGGTACTCGGCGTCGTGGCCCACGGATGCAGTTCCTGGTTCA
GCGTCAGGTACGTATCCACATGGTTTGCCTGGAGAATGGGTGTGTTGACTCCATTGGGAGCGGAGTTTCTATCGTCACTTCCGGCAGTAGCATTCCCCCG
GCCAGTGCCGTCGGAGCCACTGCCATCAACTCATCTTCTTCCAGCCCGGCTCCAAGCTGCAACTGCTGATGGGCGCGCAGCTTGTCGAACTGCTGAGTAT
GCAGCGCGATGGTGAGAATGGCCAGCAGCGTCACATACGACACAGGGTCCGTCCAAATGGCCCACACGCCTTCCTCCGTGAGGTCTCCGAAGGCCCAGTA
CACGCCCAGCATGAGTACGACGATCCACGTGAGAGAGACCGTTTGCACCACCACAATAGCTTCGAACACGGCCAGCGTCAGTGTGCGCTCCAGCGTCACG
CCAGGCCCATCGAATGCTGAGCGGGTGAGCGAGAAGGAGCTCACGGCGCGCGAGCCCAGCAGCTGCTCGCTCGTGGTGGCTGCGGTCGTAGACATCTCCA
CAATCGGCTTTTCGAGCCTCGTGAACGCGGTAGAGCGGCACGAAGGGCATCGCCGCCAGCCCCAGCGACACGTTGAGCGCCTGCAGACCGAGCCAAGTGT
CCAGCACGAAGCCCTGCTTGCTGGAGAACCAAAGCAGCAGCAGTGAGCCCAGCGACAGCAACGACGTGCAGGCCACGCGCCACGTGTAGTAGGAATTGGA
CCACTGCAGGTAGGCGTCAGCGCCGCGCCAGCCCCCGCGAGCAGGAGGCGTCGCGTTGGAAGCCATCGCGTGTCGGAATGATGCTCAACTCATCGAAATC
CTGTGAACACGCATAAAAGGTAGTAAATGCGAATTTGAGAGGGGATGACAAATTCCGACCAATAAGAGAAGAGCAGCTGCCAACGGGTCGAATTCCAATG
CATTTGAATAAGACTGGCTTGTGTTTTGTATGGGATTTCTCGGACGAACGCGGTGGACTATGTCAAGCCATGTGTGCCATTGCTATATGTATTATGTGCT
CATCAAAAATACGTTAGATGACCACTACGCTCCACGCGATCCTTCGGAGAATGCTTGGTAAACACGCACCATACTCACATGTCCCGAAACGAAACCGCCC
ACGATTGGTGGATATTTAGCCAATCGCAGTCGGCTAAAATCAGCCCGACCTGTCTGACGAAAGCAGCCAGAAACTCCGCAACACAGACAATTCCCACTGT
AGCAAAGCTTGAGAGACATTTTCCGGCATACAAAAGGCGGTCGTTCAACCAATCAACCGAACGTCCGAACGCGACTTTCACAAGGAAGAAAGCAGGACCA
GAAGGAGCGCACACGTTGCACGCGCAGCGCTCTGTCGGACCGTCGACAGCGCCAGACCGCAGGGGCTAACAGCAGCAACAGGCGCAGCACACGTAGATCT
CCGTTTGAGCTGCTCGCACCGACAGCAGACCCGTAAAGCAGCAGGAACAGGTGGACAGGCAGGTCATGGCCAAACGCATTCGAGTGACCAAGCCGGACGC
GCCCGTGGGCTTCGTAGACGTCGCCACGACGTCCCCAGTGCTGATCAACACTGCGCCCAAGGGAAAGGCCCCCACACCTACGAACGCCGAGGGGAAGCAC
GTGATGCTGCCCGCGTTCCTGTCCAAGACGTACGAAATCTTCAGTATGCCCGAGTTCTCGCACGTGTGCGGCTGGAATGCCAACGGAGATACCATCATCG
TGTCGCAGCTTGAGGCCTTCGTGGCTATGGTGCTGCCGCGCTTCTTCAAGCACCGCAACTTCCCGTCTTTCGTGCGCCAGCTCAACCTCTACGGCTTCCA
CAAGACGGTGCTGGATTCAAAGCGGCTAGAGTTCAACACCCGTACTTTAAGCGCGGGCGGCCGGACCTGCTGCACCACATCAAGCGTAAGGTTTCCAACA
GCAGCCACCACAACCAGCAGCTCGTGAGCACGTCGATTCAGGTGGGTTGATTGGCGACATGCGATCGATTCGTTGGGTGATGTTCTAATGTCTGTTGAGT
ATTTTGAGCAGAACTCGCGACTTGATGCTCATCGGGAGATTTCCGACACGCTGCTGCGGGAGATGAAGGAGCTGCGGCAGCGCAGCGACGCCATGGAGAA
GCGTCTGCGTGACCTGGAGATTGATAACGCGGTACGGGCGGCCGGTTCCAGAATATTAGACAGTGTAGCTATTGCAGGGGCTGATTATTTTTTTGCTGCG
ATAACAGATTGTGCGGAGCGACAACGTGAAGTTGTGGAAGCACCTCGAGTCAGCGAAGGACAAGCAGCTCATTATGCAGGAGAAGATGAAGAAAATCATG
TGGATTCTGTTTCAGATCTACCGAGGAAAGCAGCAGAATCTCCCCAAACTTTCTGGCAACGACGTTGCGGGTGCTGTTGTCAGCGAAGAGTAAGTGCCGA
AGGCGTGTTTCTGCCAAATGGAGTATGCAATATGTGACTAACCAGTTTTTGCTGCTGTGTGGTGTTTGCATTTCGCGCCTGCTAAACGTTGGCTTCGAAC
TACCAGTATGCTTGGACCAAAGGAATTCCGTGATGTGTTACGTTTCTTGGCGATGGATGACCCCCCTTTGTTGCCTGGGTCCTCGGCGAATGTAGCCACA
GCTACGCCAAGCTCTCGGAAGCGTAAATTTGTCGAGGTGCCATCGGATGTTGGCGACAGCTATAAACTAGGTACAGTTGAAGACACCTTGTGATCGATCA
AATTTGTTGTACTCACTTGATACTGTTTATTTTCAGATGTAGAACCATCTTCTGTCGTCGAGGTACCGAGCGAGGTGGAAGATCTCAACCCCTTTGCCAT
GACTGTTCCTTCCAACAAGCTTCCTGTGCACACCAAGATGGAGGGCAGAACAACATCCTAAGCATTTTCTCCCCGATCAATGCGATGAACAACAGTGTGC
CCAGCATTGACCCAATGCTCGGTGGATTCCTCACAAATGGTGTGGAGACGGTGCCTAGCATTTCACAAACAAGCGCATCTGCACCGACTGCATCGACACC
GATTGAAGCGGCCCCTGCTGGATCGGCATCAACCGTATCAACCCCGGATGAAGGCGCACCTGTTGCCAGCAACAGGGACTGTACTCCAAGTGACTCCACG
GTCGCGTCGAATGGTACTGCCACAGAGCCGTCGGCGGATGCAAACAATCAGCTGGCTTTTTTGGACGAAGAGCTGCCTCTGCTGCCTGACTCTCACTACA
ACTTCACCGACGGCGAACAGGTACTGTAACACATCCTGTGGTTATGGTTGTTTGCATGATTACCTTTTTGTGGATCACTGTGTAATGGGGTGTCTTGTTT
TGGACTGCGCATTAGCAGGCAGTGATGAAGAAGCTCGAGGATTTCGAGACGTCACTACTGGACGAATACGACGTCAGCTGCCTCGACACGTTGCTACAGG
TGGGTTCTAATAGGTTTTGTGTATGTGATTTTCTCTGGGAGAACATTTACTTAATCTGCTTCTGTTCTTCATTGTTGTTTTTACGAACAGCAACTGAAAA
GCTCTGGTAGCGGCGACAAATCAGCCAGTGTTTCAGTGGCAGATCCGGAGGAGGTTGTGGTGGGACCAACCAACGCGACCCCACACGATGCGTAATGGAG
ACTTATTGCGGACCAAAGTCAGCTACCATTGCGACAGTGCTCATGCTCGGAAGCTGGTGGTGGTGATTGCGAGCACCGCCTCATCGAAGAAGTTACATAT
CCACGTACATGTCAAGCGAGTTGCCGCGTGCGCGTGTCGTCACTGGTAGGAGTTGCCCAGCGCTGCAGCGATGCATGCGTGTCACTACTCTTATCGACTG
ATAGACAAGCGATTGAACACGTCGACTCGCGTCTCCTCGCCCGGTATAGAAACAGATCGAGTGTCAAAAAGTCAAGAGAAGATCAAGCGGAGCGAGATCG
CGACGCGAAACCAAGAGAAACGGAGACGAGTTCGTACGAACAAACAGCCAACAGTTGATGCGATAGGCATTCGACGGCAGCGAACGAGCGCTCCGAAACG
ATGACGAACCCATACATGCGGCTGTTTTTATTTATGCGCAAGAAGGAGAATCGAGACAACCTAAAACGAGAACAAGAAAAATGGCTCTTCATGTTGTACT
ACTGGACTTCATCCTCTAGGTGTTGGTTCTTGGCGGCGACTAGTAGCTTTATGCCCTTCTAGTTCACTGCGAAGCCGTTGGATCTCTTTGTCCTTCCGGC
TCAGCTCCAGTTGCGCCGTAACGAAGAGAGTTGAGATGTTGGTCTCCAGTTGCTTGTTGGCGGCACCGAGCTGTCGGTTCTGCTCCTGCAATTGCGCGAG
CTCATCTCTAAGTCGCGAGTTCTCCTTCTCCACTTGAGTCTTGAGATCCAGCGCCTCCTTCTTCTCCAACGCGCTCGTGGACGTGTCTAGGTCCCCGTAC
AAGTCCTCCGTGCTCATTGTCGCCAATTCGCTAGTGACGCATACAAACTCCCAGCTACAACGCGTCGGATTTAGTCGGAAACCGGTCAATTGAGACCATG
GACTCGCGGTGCATCAAGTTCTGGGAGGATGGTCAGGTGCTGGTGGCCGCCATCTCCGGCGCGGCACGGGTGGACCAGACGCAGGGCAAGATTTTCAAGG
AGCTGCGAACCATGAGTCGCTTTGTGCAGCGCAACCAGAGCCAGCGCTTCAGCGACGCGGCGCAGCAGAAGCTCGTGGACTGTGTGGGGCACTACGTGGG
ACTGGGCAAGCAGGGAGGCGCCATGCTGCCAGTGGCAGAAGCCACGTTTCAAACTGTGAAGGATGGTTTGGCCATGCCGTTCAACGTGTTTGGCACCAAG
CACAAGAAGCGGTTGCTCAAATGGTACAACGAACTTATTACCATCGTAGGCGGAGACGCGGACGCGGCAATTGCTGGAGAAGCTGCCAAGCCGAACATCG
AGTGGGGCGTCATGGACATTGACGAGGACGGGTTCCTGTCACTCATGCAGGTAGAAAGCGGAGACACAAACGAGAGCTTCCAGGTACAAAAGAAGAGCGA
AGAGTACAAACAGATCAAAAAGGCGCTGGAGAACAACGAAGTTACGGTCGTCACCAACGGCGACGACATCGTGGACATACGCGTTGAAGGAGACTAGATG
GAAGAAAGCTTCCTACTTGCATGGTAGAGCATAATTAAGAGTAGTCAAAATGCGTCGAACGTTGATCCCATCTGACGTTGTGCTTACGGTGTGATGTTGC
ACAGTTAAAACGGACTGGCAGCACCAGTCTTGTCGCGACTCTCACTCCACGCCTTGGCGATCGTGCGCTTCATCTCGTCGTCTCCTTCGTCGTACATGTT
CTGCAACCAAAGAGGAATGAGTAAATCTGGAGTACATGCATCTCAAACACATTACAAAAACAACGCACCTTCATCATATCCATGATTCCAGCAGACGGGT
CGCTGGTGTCGGGCTTGCTGGTCTTCACCGGGTTCTTGGCCGTGAGATTCATCCATGTGGTGTCCTTGTCAGCCTTGTACAGTGAGACTGTAACGCGGTT
CTTCTTGGCGCGGATCGAGCTCTTGGCAGGGTCAATCTCTTTCTCCAAGTGCTGCTTCAACAGACTACAAGCGACAACAAAAACCCACAAGAACCTCGTC
AGATGTATTCTTCTCACTCCAATTGACCACAACGCACCGGTAGTTCTTGCCATCTAGTCCAATAATCTACCGAACAAAACCACCACCATTAAGTCAGCTA
CTCCTCATTACCCATGTTATCCCCATCGAGAAAATCACGAACCTTGAGGTCGAATGACGTCTTGGTGAAATGGCACGTGATGTTCTCCTTGGGCAGGTCA
CCGACGCCGTCGATGCCCGACATAACATAGACCGCCACCTTATGCTTGCCGTAGCCGTCGTCCTCCCAGCCGAAGCGACTGATCTCCGTGAACGTGGTTT
GGTCGCCGGCCACTGGCTCCACCTTGCGAGCCGCCACCTTGACGGGCGCCGGCTGCACGGGCGTCTCCGCCTCATGGTGCGGCTTGGCGGCCTTCAGCAC
CTTCTGCTTGCGCTGCAGCAGCTGCTCCAGGTCGTGGCGGTTGCCGGCCGTCTTGGTCTGCGCCAGAGCGTCTGCAACTCCGCCACTTCAGCCGCCAGTT
CGCTCATGATATCCTCAATAAATCCAAATCAGCAAATTTACTGCCAGCAATCGGTAAATTCTAGAACGACACATATATTATACTCAGGACTATTTTAAAC
TTGATGTCAGTATGTCTAGCTTCAATGAAACTATGAAGACATATGTTTAGGGTGTCATATATTAGTGTACCCACTACGCTTTTCGCGCGCGACAGCATGG
ACGGAAGCGCCCTCGACTCGGTCTCTGCTGAGGCCTCTGGGGGCGTCCCGCTCGTGTCTCCGCCGGCTATAGACGTGGTCGGTCCCTCTGCTGCGCCTGG
TAGCGCAGGACCGGTCACCACGGGCCTTGTACAGCCCTCTCAACGAGCGTTTCGTTCGACTCCCAACTCCACGCCCAAGGGATCCCCAGCGCGGCTCACA
GAGGCGTCAATGGCTCAGTACGGACAGCAGGAGGTGAAGCAGACGCCCGATCGGCCGGCGACGCCAGAAACCGCGTCTTCGGGTTCTTCGCAGCGATCAG
GAAGCGACGCGTCCGAGGGCGAAAAAGGCGGCGACAGGACGCAAAATAATTGCCCAGGAGACGCTAATATGCTACAAGATGGCAGGAGTGATGGTAGCAG
AGTGCAACAGATGCAGGTGGCAGGGTGGATGGCAGGGCAAGGAGTTTCAGGACAGACCAACGGCGTTTTTGCTGTTGCGGCGGCGCCTGCTGCTCCTGTG
CCTACAAAGAAGCCCAAGAGGTGGTTCGATGTCATCCCGATGGTACTGCAGAACTTCAAGGCGCACGACCAGGAGCAGGTTAAACGTACGCGATGGATAA
TGTTGGGATATTTGTTGGATTTTTGCTGACGTAGCTCTTGTAATCTGCCATTTGGGTGTGGGGCTTTCAGAACTGGCGCTGCCGCAGTGTGTGGTGTGTA
AACTGTGCGAGAAGGCTCAAAAGGCGGAGGTCAAATGTCGACAGGATGACTGCAAACTGGTTGACCAACCTTTGTGCTCGAGATGCTGGGAAACCTCCCA
TTCTTCAGACGAGAAGAAACAGCACCGGCAGCTTCCCACAGCAAGTGAGTCATTTTCTTCTTCTTGGTTTGTAATGCTGCTGTACGCTAATCCATTTTTC
TGATAAAGTTTGCCAACAGTGCGAGGTGGATCGAATTACCTTTTGGTGTGCGGATTGCGACCTGAAGTTTTGTCAAGTGTGTTTCGATCGAATCCACAGT
GTAACCAAGACGAAAATCCATCGCAAAGTAGCCTCAGAAGGTACGTTTATCGCTGCAAACTATTCACATGCGGTCGAGTTACGCCGGAAAGTGCTTACTG
TTTGCATGTTGTTAATGTCAACAGATGCACCTGGAAGCTGTTTGGTAACATCGGACTGGTCGGAGCCCTTTCAGAATGCAATTATGCAGATGATTGCGGC
GCGGAAGCATCCACCTCCGGCTTCGGCTGGCAGTGGAGGGGATTCCATCGGTGGAAAACGAAAGCGGGATATTGAAGTAATCGTTATTGACGACGATGAC
GATGAAGATTTTGATGATGCAAGTGCGCCCCCTATCAGCAATGGAATTTCCGAGCAGCATGCTCAAAATACGCAATATGGCATCAACACTGGAGCAGAGA
ATGTGGGAGTAGAGAATGCATTAACGCGTTCCAATGCAGTATTCTCGCAACTCCAAATGCCGAACCAGGCTGTTCCTAAAAGCACATTGTTCGAGCCCCC
AGTTATCCAGAACGCTATGATAGAGCCTATTCCGTTTCCTCAGGAGCTGGGAACCGCATCGTCATCGCTATCATCGTCTGCTGAATTTGGATCGGCGCAG
ACTAGATCTGTTGGCACAATATCGTCAATATCAACCGGAAACAATACAGTGAACATCAACACAAACGCGGGGAGCTCGCAGTGGAACAACGAAACAAGTC
AATTTGCAGCATCTGCCTCCATGGGATCAACAGGTTATACCGGCGGGATGATGAGTGTAACACCGAGCTCGACACCGGCTTCTGTAAGCATGGCAAATGG
AGTGTGGTCGACAAATTCTGCCATTAGCACAGATTTGGCCAGCACATCCAATTCTGGCAATCTTTTGCCACTCGGGGATGCAGTTTTTGCGGAGAATGCG
CTGGTTGATTCTTTGATAGACCGCTATCATGAGATGAACCAAAATGTAACCAATATGGAGCTGCAAAGCGAGCAGCTGACCAGACAGATAGCAGTCGCAA
CGTGTCAAGGTCCGTACGCAGCAGGATCCATAATGGGCATGCTAAACAAGTTGCAGCCTGTACTGGAGGCAGCAAGAGAACGACGCGACAAGTTTTTGAT
CGCGATGATTATCCAGTCGAACGACATCATGGCTGCTGTGCGACTTCTGCGCTTGACGGAACTCGGTGATGTACCTCAGGTTCCCATGATTAGCCACCGG
AAGTGCCTGCAGATATCCAACGAGATCAATCAGCACAAGAAGAAGCTCCTCGAACTGAATCAGCAGCTGAGTGAGACGCTTAACCTGTCTAATGTTGTAA
GCTCCAACTGGGAGAACACGCTTATTCGAACTACCAGTGGCAATATTCAGATGCATGAGAAGAGCATCAAGAAGCTGAAGAAGGACCGCGAAGTGGAAAT
TGTGCGTATTGTACAGTTCAGCAACAATATCCGCGTGACACTGAAGCTGGCGTTTCAGCGTTCTGTGGAGATACGACGCCAGCATCAGCAACAGCAGCAG
CAACAGTTTCAGCCGTATGGATAGTTTTGCTATCCAGACGTCACGCGAGACTGAAAAGCGAGGAGCGACAACGATGTAGGCAAAAGACCAATTATTTAAG
TGGCAAATGAATGCACCAGTGTCAACCGTGCCGATACACAAGGAATCCAATCTGCCCCAGAAAGAAGTACAGCATCCTGCGAGCAACACATGGTAATGCA
TGAATTCGAGCTAACTTTTGCATAAGATAGCAGGTGAACTCACTTTTTGACCTCATGCGAGACGAAGGAGCCGAAGGACTTACCTACAATGACATGCCAC
GCACCTCCCTGGGTCTCTTCGATTTCGTGCTTGATTTGCTGCGCAACCTCCGTGAAGTGGTTCTTCTCGCCCTTGTACAGTGCTTTGAGCGCATTGGTGG
CGCTAGTGAGGATGAGCTCCTCCAATTCCTTGGTTGTGTCTTGGTACACGATGCGCAGGCCACCGACAGACACATCGTCCTTCTTTTGAGCCTTGGACAT
GACTTTGATCGCCGAGTTGCTGTATCTTTTTCTGTAGGAAGTCGACTTGTGCACGACCGTTGGTATCCAATCGAGACTTGCTAATTCGAGCAAGTTGGCA
TTTAGTCGCCGCTAACGAAACGAAGATGTCAAGGGGCAAGGACATTTTCGAGCACCTGGTGCGGCAAACAGTGCATACTGTGCTGTTCAGCGATACATCG
GATCAGCACCATGAATCTGCAAACGATTCTGTTGTCATAGTTGGTCCAGCGACACTGAGCAAAATGCTGTCGAGACGGCAACCGCCATGGAGATTCGCTC
TGATACGCTTCTGCATCGACTAATTCACAACTACGACAACCATACTGAAAACTCATCTGAAGACGAGAGGGGCAACAACGCTGATGTTATCAGTTGCACA
GCATGGATGAAGGACTGTTCGAACTGGTCCATCGAACGACTCAAGACTGAGAAAGCTTTAATCAAGCAGTACGTGCAGGAGCATCGACGAAAGCGTGCTG
AGGACTGTCACAAGTCTCCCGAGATGCCTGCTGATAACTTCACAATTCACGAGGCATATGCACTGCTCAAGCTTTTTCTCCTTGAGCGGGATCCCGACTA
TCGACAGTGCCTACTGCAATCCATCGAGTGCGACAACTCATTCTTGCCATCTCTCCATGTACAGCTCACACTGTACGCGGCGTACTTCGAGCGCACCAAC
GGAAGACCGGTACGACCGTGATGGTATATGCAAGTGTAGTCTCTTATTCAACTTCCGTTTGGCATCCATATTGTAGATCTCCCTAAAAACTGACGTGGAG
CCTATCCAAACGCTCTATGAGTTCTTCCTCGCCCACCACTGCGCGTCCGAGTAACAGCTAGCCAAGTAAGAAACAAAATGTACTGTCTCGCATTCGTGGT
GCTGTATCGCTGTATCTTGGAGCAACCTACAGGTAGGAGCTGTACGTCGGCATGATGTCGTCCTTCTTGGAGTCCAGACACGGCACCGACAGCCACGCGA
AATAGAAGGCGGCGCCGCCCATCACGTGCATCAAACCCTTTGCGAACCCGAGCGCCGCGTGGTTGTCGTCGTCGCTGAAGAAGACGGCGCCGACCCCCAC
AATTGTCGCAGCGACGAGACAGCCCACTGCATACGCCGCCTTCTGCTTGTTCAGAGGGGAAATGTTGCTGCTCTGCGTGGCACGCGACGGTAGATGACGC
GAGGATGTAGCAGACTACGAGGAGTCCCTCGTAGAGCGCCGAGTCCCATCCGTCCTTGGTCTTGAGCAGCCACGCGCCCGCGAACGCCACGTAGCGCAGC
ACAATGTTGTGATTCTCGTCCTTGTAGCCCATGAGGTGCACGCAGAGCAACAGGAAATAGGCCACAGACAGCACGTCCGAGAGGAAGTGCCACTGATCCT
CCTTGAGGAACAGCTGCGTGTCGAAAGCCTCGGCGGCGTTGAAACAGAAGGAAACCACGAGCTGCAGCACGCCCACGAACAGCTCGAAGTGGCGGCGGTT
GCGCTTCATCACGTCCAGCGCCGGCAGCATGGCCGCGTCCGTCAGCGCCAGGAACACGAAGCGCCCGAGCTCCAACAGCATTTTCCTGTGATTGCGATCG
CCCCACAAAAAGTATCTGACTACTCTTTTATCCACCAATCACGTCCATACCCTTTACAAACCGATATCATGTATTTTGAAAGGTAACATGAGTGAATGCG
AATCGACAGTCGCGTGATTTTAGGAACGAGCCATCAGTGCAAATTGCAAAGCACTTCTCAATTTGCGCAACACTGGATAAGATTCTCTCCATGACTGCAG
CTTCTCCGACGCCTCTGCTGCTGGACGGCAAGGCCACGAGCGACGTGGTCCGTACGCAGCAGCTCAAGCCGCAGTGCGAGGCGTTCCAGAAGAGCCACGG
CCGCCCTGTGGGCCTCGCCGTGGTGGTTGTGGGCGCCCGCAAGGACTCGGCCACATACGTGCGCATGAAGCAGAAGGCGTGCAGCGCCGCGGGCATCGCG
TCCTGGAAGATGCGGATCTCACTAGAGCAGGACGGTAACGAGAAGCCCGCGGAGAAGGTGACGGCGGAGCTGCTGGCGACCATCCAGACGCTCAACGAGC
GCGCGGACGTCGACGGCGTCATCGTGCAGTTGCCGCTGCCCTCGTTCTGCGACGAGGACGCCATCCTGGCCACCATTGACCCCACGAAGGACGTGGATGG
ACTGCACCCGGACAGTCACGCGGCGCTCTTCCAGTTCGCCACCAAGAAGACCTCGTCTCAGCACGACGAGGCGCCGTTCAGTTTGCCCTGCACGCCTGCG
GGTTGCATGGAGCTGCTGGACCATTACAACATCCCGCTGGAAGGCAAGCACGTGGTCGTGCTCGGTCGTAGCCAGGTCGTGGGCCTGCCTGTGTCGTTGC
TGTGTCTGCACCGCAACGCCACGGTCACCATGTGCCACTCGCGTACGCAGGACCTGAAGGCGCGTGTGCTTGAGGCCGACATTGTCATTGCGGCTATTGG
ACGACCGCGCTTCGTGCAAGGCGACTGGATCAAACGCGGCGCCACGGTGATCGATGTGGGCATTAACCCCGTGGAAGACGCCTCGAAGAAGAGTGGCTAC
CGTCTCGTGGGCGACGTGGACTTTGACGGTGCAGTTAAGGTCGTGCATGCCATCACTCCTGTGCCAGGCGGCGTTGGCCCCATGACTGTGGCCATGCTCC
TGAAAAACACTATCCAGTGCGCAAAACGACGCGTGCAAAAGCAGTAAAACACAGAGGATACGAGCGACGGAATCCATTCAACGCTTCCTAAAGTTTGGAG
ACTCACCCTGGCCCAGCAAGCGAACAAATCGACTTTGCCCGGCTTCGGCTGCTAATCCTAGTTGGTAAGGCGACAATTGTAAGTAAAGCGTTCCCTGACC
CCGTTCACTGCCTGTACGGGCCCGCTAGAAATCGTCGTGATGACCGAAGAGCAAGTCCTCCTCGTCCTCTGACGAGAACTGCCCGCTTTCTTCTACGAGC
TGCACGTCTTGGTGCAGTTCCTCCCAATATCCTCCGTGTGATTGCTGAGCTAGAGGGGCTCCTGTTGCCGCTTCATTATCGCCGTCTGCAATCTCCAGGT
TAGTGTCCTCATCGTTGTCGGCAGCTTGCTTCTCGTGGAGATGGTTCACAGCTTCCTCCAATCGTTGCAGTGCCGTCTTCGCACTAGCAGGACGAGCTAA
TGCGGGTTGTTGCTGATGCTGCTCCTTCGATTCACCTGTAGATGCAGCTCCGAATCTCCGTTGGCCCTGAAGCAGTAGTCGCATGCAATCAAGTTGACCA
TACGCCGCAGCGATCTGTGCCGGAGTCTCCCAATCACTGTTCACAAGTGTTGGGTCTGCACCAAGTGACAGCAAATTCTGTGCCACCGCTGCGCGACCAG
AAAATGCTGCCCAGTGCAGTGGGGTATCACGTCTTTCGTCGGCGGCGTTCAAGTTTGCTCCGTGCTGCACTAGTCGAGCAATGATCGAGAGAGCAGCAGG
CGATTCTACCGCGTAGTGCACTGGAGACCGATGCAAGTCATCAAAAGCGTTGGCGTTCGAACCTCCGCCAGGAGTCAACAGAAAAGCTGTCATGGCAGTA
TCGTGCGTCAAAACTGCAAGGTGCAGTGCTGTTCGACCTTGTGAATTGCCTTGAGCTTGGAGCATGCAATTCCATTCGTAGTTCACTTCCGTAGGAACCA
CAAGTTGCTTCGTGCACTCGACAAACCCTCTCTCGGCGAGGCAGTGCACTGGGTATCGTCCTGCGTTGTCCGGCGTGTGAAGTGACAACGCTGCTGGGAC
AAGTGCTGAGATCGTCTCTATCGGGATAACATTCTCCGCGATTGAGTCCTTCATCATCAGCTGCTGCAAGAAACCACAAATCTCGACCTGGTCGTCCTCA
CAAGCTCGATGTAGCACATTTTGACCCTTACGGTTGGTCGCTTGAACGTCGGCACCATGGGCCAACAATTTCTGCATAAAATCCAGGTGGCCAAGTGATG
CATACAACATCAATGGCGTATCACCGTTGCAGTCAACGGCGTTCACGTTCAAGTTTGCGCCGCAAGCAAGTAAGAACTCCAGCATTTCGGCTCGTGATCG
ATAGTTTTCCTTGGAGAACGACAGCATATGCAACACACTGCGTTGCATCTTTGGCTCAACTGCTGCAATATCGGCACCTCGCTGCTGGAGGAAAGTAGCG
TCTTCCACGGAAGCGTTTTCGACTGCAGTGAAAATCGTGACTTCTTTCTTCGATGGAGATGATGGGGTAGATTTGGCAATTGGGGATGCGAGCGTCGCTG
GAGCATTCTGGACACTAGTGTCAATCTCTAGAAGCTGCTGGCGTCGTATTTGAGCACGGCGTTGACCCATTTGCCGTAGTAGCGCAACAGAACGGGATAA
CTCCATTTCGTCAACATCGTGATAGCAAAGCTCAAGTCTCACGTTATCGTTGTCTTGCAAGCAAACTGGAGACTTCAGTATCGGCAACGCAACGGTCGTA
AGTTCCTGAAGAATATGCTGGATTTCAGAGGCCAAATACTCATCGCTTGGCTCAAACAGTTGAAGCAATTTACGTGTCATCTGCGAGTCAAAGCGAAGTC
GGAGTGGTGGGAGTACCTGCTTGGAATCCATCCGCGCACCAGCAGGGGTATTTGATTTCGACCTCTCCCATGCTAGCCAGGCACTAGCTCTTTTGAAGTA
GAAATGAAAAAAATTGCCAGACATCTCACCGTCTAAATTGCCTGTTGTAGTCGCAAGCGAGCGTTGACAGTAGAAATACATCCTTTTGGCGCTTCTGGTA
CTCGCGAACAAATTTCTGAAGTACTCTCGCGGCATCATGATAAAACAAAATCTGGTTCACACTGCGTGTTAAAATGTGCGGCAGCTCTCGGTGGCTCCAG
TCTTCAACGGTACTATCCACATCAGCTCGAGTCGTATCCTCCTCTGTTGTCTCAATCGGCTCGAGCAAGTCGCACACTGGTTCGTTGTCCTCTAACGAGT
CTATTGGTTCTTTATCACGCGCTTTCTCGGTCGTTCCTTCGTGCTTGAGCACTTTTTCGTTAGGGATCACCACGTCCCCCGGAGCATCCTGCAACTTTCG
TCGAGAAACGATAGCCCTCTGAATTCGTTTTGCAGCAAAAGAGCGTTTAGCCACCAATACCTTGCGCTCGATATCTTTTACCTCCTGAATGAGACGAAGC
TCGTCATCCTTTACAACTGCGCGCTTCTTTTGTCGTACACCTGTGATCCATCTCCGCCAGCACATTTGTACTTTACTAGCGAACACTGATACCATAAGTC
GATATTGGCGAATTTCCTCAGCTCGTTGAACTTCCAAGTCAGCCAAATACTGCATCCTGCATAACTTCCCTTTCCAAATCGCCTCGATCCTTGTCGCTGC
ACTATTTTCTCGTCGGTTTTGGTGGTATTTGTTTACTGCTCGTGCAATGCGTCGACCATAGGATCGATACTTGATGGCATCAAATTGTTGCTGACGCTCT
TGTTCAATGTGTTGAAGTTGCTCAGCGTCGGGTTTTGATCCTGGTACTCCTTCGGCTTTGAGTTCCGCCGTTAAACGTGTTCGGCGGGTTTTAAGCTCAG
CATCATTGCTCTTTTTCCTGTGTCTCTGCTCTAGACAAAGATGTCGCCTCCTTCGCCAATGCTTTTGTATCTTTAAGGCGCTCAAATTCTGTTGTGGCGA
AGACGTTCGTGTGCCACTTTTTGTCGACGTTGGGAAATCCCCCAGCTTCGCTGAATTTTGAGAGAGCTTTCGTACTGTTCCTGGCGTATACGATCCCTTT
CCAGCTCTTCTTGTTGTTCATGGTGCCACTTGAGCCACAATGTCTGGATCTTGAGCGCACTCATGTGCTGCTCGTGCTGAATAAGCTCTCGCTCCATTTT
GCGGCGGTGTTGTCGATTTCCCCAGTTTCGTTGGATTTTCAATGAACTCGCATTCTGCGTTTGTACCAGATATTCCTGCTGAAGTTGTTCGTCTTTGTGA
TGCTCCAACTCAGTGTTCCTCTCCATGCTTCGTCGCTGCCACCATCGATAACACGCACGTTGTATCCTCGCCGAACTTAGCTGCAGGTTTTCCTTACACT
GCCACTTTCGCCAATTCCGTTGGATCAGTGTGATTGACAGCATTTGTACGCGCTTAACTTCCTTCTTCTCCTTTTGCCACTTGTCCCAATGTTTTTGAAT
TCGCTTCGCACTAAGGTCTCGTCTTATTGTCAGCTCGCGCCATTGACGCCAACATTTTTGGATCTTTCTCGCACTAGCCTGTCTTTGAATTCGAAGCCGT
TTATTTTCCTCCTCAGCTCGTTGCCACTGCTGCCATCGCAGCCACCTCCTTTGTATCATTTGGGCACTAGCTTCGCGCAAAATTCGGATTCGTTCAGCTT
TGGCTCGCTGCTGTTGCTGCCGCTTCCGCCACCACCTCTGTATACGAAGCACACTGGAAAACACAACGCGTTGAACTTCTCTTTCCTCTTGCTTGCGTTC
GACCCATCGTCTCCACACAGCCTGAACTTTGCGCACGTTTGCTCGAACTCGTATCGCTGCCAAATGGCATCGAACGTTTGTTGGTGGTGGTATCTTCGAT
CTCGCTCGCGCTTGACCCACCGTCGCCAGGCACTCTGAATCTTGCACACATTCGCTCGAGTACGAATAGTCTCCAGACGCGCGTTGAAAACCCGTCGTTG
TTCATTTCTTCGTTCACGATCGCGGATGACCCATCGTCTCCAGACAGCTTGTATTTTTCGGACGTTGGCACGAGTGCGTAGAGCTTCAAGGTGCATATCG
AACGCAAGCTGTTGGGCACACTTTTGTTCTCGCTCACGTATGACCCAACGCCTCCAAACACCTTGAATTTTACGGACGTTTGCTCGAGCTCGGATGGCTT
CCAGGCGTGCATCAAACAAAACTTGTTGCTGGTGCCTTCGTTCTCTCTCGCGTACAACCCACCTTCTCCACGCACCTTGAATTTTGCGGACACTTGCTCG
TGCTCGGATAGTTTCCAAATGCATTTTGAAAGCTTGTTGCTGTTGATTTCTTCGTTCGCGTTCGCGTATAACCCCCCGTTTCCATACTCCTTGGATTTTG
CGAGCATTGGCCCGCATTCGAATCGCTCTCAGATGCGCGTTGAAAGCGAGTTGCCTACGTTCTCGTTCGCGAGTGATCCAGCGCCTCCACACACTTTGAA
TTTTCCTTACGTTAGCTTGAACTCGAATGGACTCCAGGCGTGCATTAAACAACAGCTGCTGTTCACGTCTTCGTTCCGCTCGCGTATAACCCAGCGCCTC
CACACGCATTGAATTCTACGAGCATTGGCTCGAACTCGGATCATTTCCAGGTGCGCATTAAAAATTCGCTGTTGTTCACGGCGACGCTGTTGTTCTTGTG
TCCATTTTCTCCACCAAGCTTGTAGCCTTCTAGCGAGGGCTTGCCGTTGCTTGTTCTCCTCTAATTGAGCAAGCGCCAGCTCTTGAGCACGCTTGATTCT
TTGATGGTGCGTCCATCGACGACACGCTCGTTGAACTTTCCGAGTACAATTCATGCAACGCAAGTACTTCAACCTGGTCGACTTGTGCTCCAATTCCTTT
TGAAACCTAGCGACAGTATCAAGCGCCAGACTCACACCTTTGCTACTTTCACACTCTGCAAGAAGCTTGACTGCAATGATGACTTGTACTAGTTGGGCTC
GAGTTTGCTCAGCAATAAGCTTATCCTGAGCAGACTTTTCGTTTTGCTGCATTCGTATCATTCCCACGGTTCGGTTATTGCGATGTTGACTGATGCGTTG
ATGCATGAAGCTCGAAGCCTTAATCAAGGCAACTTCGTGCGTCTTCGCTTCGATCTCTTCCTTTGCCTTCGTTTCTCCTCCTCCATCTCATGTACCGCTG
AGGCACAGATTGCAGCCTTTTCCTTCTTGAGTTTTGAAAGCTGCATCTGTCCTGAAACCCAGGAAGCGATCACCTGCATGCCAGCCTCGACTCGACTGTG
TTCCAAAAATGCTGCTGCTCGCTGGCTTCCAGCTGCTTCTCCGCTGCTAATTGATCCTTAGCTTGTAAGAGGGCTTCAGGAGCGTGCTTCAAGCTCAGAT
AAGCGTCGTTGAAGCTCAAGCGCAAGCGTTGTCGCTGTTCGTCGCTGCTCAAGCTGATCTTCGCAGGACATCAACTCGATCTCCATCTTCTCTGCTTGAA
GGTGTGCCTGTTTCATCAAAAGTTGATGTTTCTCGCTTTCTGCTTTCCTGGATAGCACCCGAGCATCGATAAAACCTTTGATCTTCTGCCTAGCAGCATT
CTCTTCTGAAACCCTTTCTCGTTTTTGATGGGCTTGAGCAATTTTGCGATGTCGGGCGTCACTTTGCAGTGCTTGTTGTGCCATCCGATCAAGTTTGCGC
TCGAGCACACGCACTTGGGTACGCGTCTTGTGAACGCGCTTCTGGGTTTCAATTCCTAGTTTCTCCTTCGCAAGCAGCTCCTTCTGAAGCTTAAGCGCAT
ACTGTTTCTTTTCCACCTCAACTCGCTGCAGCTTCTTGTGAAGAAGGCATACTCTGAAAAACATTTGAATCTTCATCGCTGCCAGTCGGCTTCGTCGAAC
CTCAACTGCATGCTGCTGTAGTTGTACGACGCGCTCATGGTGCGTAAGCAGTTGCAACCTTTCTTCCTCTGAAGCCTTCCATCTGCGATCTAGTTCCGCC
AATCTAGCGTCCATGTCCGCAATCAATTCACGTCGATGCTTCGAATTGAGCTTCATGGTCTTCTCCACGTCTCTCTTAGCTTTTGTCCACTTTAGTTGCT
CCTTGAACATAATGTTCTTGGTCAACTCTTGAGCTGCTTTCAACTTGCGGCGCAGTAAAATCTCCATTAAAAACCTTTGGATGTCTTTCAAGGCTCTCGC
TCGTCGTTCTCTTTCTCGAACGAGTTTTTCTCGACGCTGCTTTTTCTTCTTGACTTTCGAACGCTGGTGTCTCCACCACCGAACCACTTTTTCCTTTGCA
TATTCTCGCTGTCGCTGTCGAAGCGAAATGCTCACGAAGAAGAGCATACGATAGAATCGCATATGGTCAACCGGAAAACAACTTTGCGTCTGGCCACCTC
CTGATTGTGGAGGTATATCCTCCAGTTTCGTTGGATTCGACACGCAGCGATCGATCGGACACGATGATCTTCATCTCTCCGAGCTTGCAATCGTCGTTGA
TGATGGCAATAAATAAATTTCTTGATCTTCCGCCATGCAACTGCTCTGCGAACGACCTGCTTTGCTCGTTTTTGCTCTGCGCAAGCCTCTTTCCAGTAGG
TAAAGTTTCGACGCAGCATCTTCAGCTCTCGCTCCAAATACTTTGGAGCATTCCCAACCGGAATTGTAGGCGATGCATAGCCCATTAACGACGAGTACGG
CTGCGCTACCGACAGAATGTGGTCTTCGACCTCGCGTTGGGACACCCAATGACTCATGTCAAATGCTGCAACTTGAATATCTCGACAAAGTGAGAAAATT
CGGTTGAACTCGGAAGGTTCGCTTTCATCGTCACCCTGATAACTCGACGATGCTGAAATATTGCTGCGTGATGAAGGAAAAGGAGAATGAGCTGCCTGTC
CAATCACCACTACTCGTGGGTTACTACGTGATGAAGCGGGTGTCGAATTCATCACCTGGTCACTTATCATCGTTGGTGCATCACTACGGGATGAAGTTGG
TGAAGAATACGCCGCCCGTTCGCCTGTCGCTGTTCGTGCATCATCAGTACGAGATGAAGCTGGCAACGAGGGTATCGCGTCGTCTCTAATCATAGTTGAT
GCATTGCTACGCGATGAAGACAGCACCACATCTCCGCTCGCCATCGATGGAGCTCCATAGCAAGACGAAGGGGGTGAGGAATATGCCACTTGATCTATGG
TCGTTGTCAGCGTACTTGTACGAGATGCAGCAGGAAAAGAATGCATCACAGGGTCAGATGCCACACTGCTACGGAATGAAGATGACGAGAAATACGCAGC
CATATCGTCGACTGATGAACTGAGATGCACTGCGTTTTCAAACGGGGACTGCGCTTCATCAATCGATCGGTAGCTGTTAATTCTGGGAGAATCCAGACCT
CATGGCTCTCGGTCGGATGTTCTGATTCCCCTTCAGGAATTGCGAATGCGTCGTCGTTCCAGACACTTGGAAGTAAGCTCAGAGCCATCGCGATGTTCGA
AACAGCACTGCTTGATGAGTACAGCATATTCATCGTCATCTGGTGTCGCTACCTCTGTTCGTTGCTCAACGCTCTCCGTCTCGCTTGTAATGCTTTCCAT
CGAAACGATAGCTTCACTTTGCATAGATCTATTCGTTGGAGCAGGAGATACACCAGCACTGGATAGTATCGCTGCCATTGCTGGCAGAACCTCGCTCTCG
ACATGATCTGCTTCAAGTTCTTCTGCCCTACTTGAATCCAAGCTTTCAGCCGCGTTGGGTGGTATTGCTTCCTCAGGCTTCAAGACTTCATCTGTTAATG
CAGACTCTGAAAAAGAAAAACTCGGTAGCATTTGCAGCGCCATCGCTATACTCGACAACGCCTCGTTCGATGAATACTCAAAGTCGCATTCATATCCATC
GTCATTCAACTCGGCATCATTTTCCACGTCATATTCAACGAACGACTCCGTCTCAGTGATTAAAGCCGCTTCAACATTCATCCAGTTGTCCATAGTATTA
CGTGAAGAAGTCAATTGTTCAATCTGGAAAGAGGAAAGTAGAGCATGAGAATCTAAAGCATTGAACAGCATTGGTTCTTCGAGGCGTACAGAATGTCCAC
CCTCCTCCACCGATTCCGAAAAATCTACTTCCGTGATGATCGGGCCTGACATAATATCCAAGTTATCGACTTCTCGTTGAGGTTGGTCCTTAGTCACAAC
AGGTACGGATGGTCTCCTCACACTAACCAGATTTCCAGGTCCCTCTTCGTAAACCTGCATCGTTTCATCTCGCGATGATCGCGCGGACAACGTACTTGCT
GATCGTTTCGTCATCGGTATCTCGTCTTTCCCGCTGGCAGCTGCTGGCTCGCTCATTTGCATTCCAACATCGACGAATGTGCAACGATGATCGCATTTGT
CCTCAGAGTTGCTGCTTCTCTTTTTGGACGCAGGTCGCTCCGAGTGAGTACTTCTGCTAGAGGATTTTGCTAGCGCTGCTGTATCCAGTGGGGGAAGTGG
CAGCACTAATCGAGTAAGTTCCACGGTGTCATCCTCCCCTCCAATTCCAGTATCAACAGTTCTGGCCGACATTTTCCTTGCAAATCGGTGAATGTCCGAT
ACTGGTGACGCAGCACTATCCAAAATGGTGTTTTCTTTCCCGGTAAATCCTGAATCGGGTGGACTAGAAATTGGTGTCCATGCCGATGTTGGCGGCGTTG
CTGACCTGGCGTTCTCGTTCTTTGACGGTCTTCGAACTGAGGCACTTGAGGTTGTCGATGGCAATAATTGATCGGGCACAGTAGGGGTTAAAGATCGTTC
AGTAGGTGGTCGAGCGTCCAATTTCGCTACGGTCTTCGATGTTGGTGAGCCAGCCCACGCCTCCACTACAGTTTTTTCACTTTGAGATGTGTCTCGCCCG
CCTGTGTAAGCTAGTCGAGAACCCTGACGATCCAACCGTTGTATCCGTTCATCTTCAAATGTACCATATCCATACGACACATTCTCTGGCACACGGTGTT
GATGCAAGTGCCTCCTATGCTCTCCATGAGACTGCAGATATCTCGGTATCATTCGAACAGCATTGTACCGCGTCTCAAGGTCCATCAAATGTAGCAATGC
TGCTGCCACACGTTCTGCTGGTAAAATTTGCCAACCTTGGAGGTATCGTTGGGTCTGAAGCGCAAACGTCTCCAGTTTATGAGTCAATAGCCGCAACAGA
GACGTCGATGACGACGAAGCAGAGCAAAATAAGGCGCCGGACGTTGAACTTTGATGACAGGAACAGAGCAGCACCTCCGATGAGTCCAAGGATAATCCAT
CTACGAATGGATTTCGCGTCAAACTCACTTCAAAGTCCTCGAAAAAGCGCTGTAGCGGTGGTGAACACGCCAGGAAGTCCGAGTCGGAAGATGCCATCTG
CAGCAAATACCCGTAAAAATCTTGCTCCAGGATTTCGTGTTCACCACTAACGCCCACGACATCAGAGCCGCCAAGCTCACTGCTTAAATACACCACTGCC
TCCACCACCGCAAGTGCCAGACTGCGCATCCTATTCAGCAGCTTCACCACTCGCTGCGGCACATTTTTCTCCACGTGCGATGCTCGATGCAGCGGCAGTA
CCCCCATGAGTTCTTGCTGTAAATGGGCCATCACTTGGTCGCGCAGGTGCATATTTTGTCGAATTGAGTCGATCACAATCTGGGCTGGCGACTGCTGTAA
TGGTGGCGAACGAGTCGCGCGCTGTACAGAGTTTGCATTGCTGTTGTGAGGAGATTGCTGGTAGCGGTGAGGTGCCGCGTCACTACGAGTGCCTTGCACC
TGTTGTTTGAGCTTGTAGGGACTGGAGAGCCTCCTGGCTTGAAGCTGCTGCATCTGTCGCTCCGTAAGAGGTTTGGCCGCAGATTCTCGAGCAGCTCGTG
TCTGCAGTCGTGGCTTTGGTTCTGCACTGAAATCTTGCTCATTTCCAGGCTGGAGACTTCGGCTGTTGTTTAAGTCCCCTGTGTAGGTCGTTCTCCTGCT
CGAAGGAGCCTCCGACTGCCATGTCGCAGTTTGCTGCATACCCGCTCGTAGGGTGCCTTGGTACATCGAGTCGTCAAGCTCCAGCTCCACTAGAAGACGT
TGCTGATCATGACGTCGACGGCCACCGAACTCCGTAGCTCTGCGCGGCGGGGGCTTTTCCCACCCCACAGGAAGGTTCTATCAGCCATAGCCTTTTATAA
TTAGGCGCCACTTGCCAAATGCCCACTCTTCCTGCGCGCCGCTGAGCGTTTCCAAGAAACGTTTCGTCGGCGAGCTTCTTCATCGCAGACACCTGCACAA
AAACCAACAGGGTAACGCAACAAACACAACACTAGACTGGATATGGGTGTCTTAAGTTTTACCGGTGGGACGGTGATCGGGATTAGCTCCACTTGTTCCT
AGATAAGCATATCGCCGTCCTCCTCTTCCTCGCCAGTTGTCATAGTCGTCAGTCCCTGGGCTCGGTACAGATCAGCAATCTACAGGAAATAGTGGGGGGA
AATGAATGGTAAACAAGAGTTAGTACCGGATCATGAGCAAACACATTCAGTGCCGGAAACCAGAAGTTCGAGCGGACCTGTGAAGAGTTGGTCGCCTGCG
TAGTCTCCTTGTCGTCACGGATGCGAATGAAGCGAGGGAAGCGTAGGGAGATGCCCTTATCCTTCGCCACTAGGCCGATGGCTGCCGTGTATTTGGGCGA
GATGGACAAATCTGCGCCTAGGATCTCCCACACGCAGCTAGCTTCGAACCAAACGTCAGGCTTGATTCCTTCGTTGACAGCATAATCGCTTGGCGCCTTG
TCGACCACTTTCTCCTTGAGCTGCTCGTAGAACTGCTTGAGCACTTCATCCGACAAACCGGTGCCCAACTTTGTAATGGGTTGGTACATCTCGGTGTCCG
GGTCGTAACATGCAAGCAAATACGCGCCGTAGACACCAGTACGTTTACCACGTCCGTAGAACGCACCGATCGGAACCAGATCAGCGGAATCGCCAATGCC
GTCGAGGTAATCCTTCTTTAGCTTCAGCCACTTGTGCGAACGGTTGGCCGGTTCATATGTCGCCTCCCTCTCCAGGGTCTTCACCATCAATCCTTCACAG
TTCTCACGCACAGCCTCCTCCAGGAAATTGCGGACCTTATCAACCGCCTCTTCCATCGCCTCCGCATTATCCTTCACGTCGACACCATCTTCCACATCTA
AGGAAGTAGCAAATTCGAAGTTGCCGGGCTTCACTTCGAACATATCCCGCAGCTTTTCACGGCGTTTTGCCAGCGGGGTGCCCAGGAATGATTCGCCGTT
CAGGAACAGCAAATCGAAAGCGTAGATACAAACAGGGATTTTAATGTCTTCCACTTTCACGTTCTGCGACCACAGTGCAAATAAAATCAGAATCCAACAC
AACCTAGAGATGGTATCGAGAGTTTTGCACCATACCTTTCGAGAGCGCGTGCTCAGAATCTGGAATGGAAGGCGCTTGTTAGTGACGCGGTCCACCGCAA
CCACCTCTGCATCAACAATGCAGCTTTGAACAACACCCTTCCTGGAGGCACTTGAGATCGCCAACTTGACATCCGGGAAACGCTCCGTGGAGTTCTCAAA
ATTGCGTGAGAAGATGGCAATTTCGCCATTCGGAAGAATGTGGATCTGCGCACGTTCACCGTCGTATTTGTACTCGCAGGTGAACGGCTTGCCCTCAAAC
CGATCGAACACCATTGCGTACGCCTTGGTTGGTCGCGCGAGCATAGGAGACACGGGTGTTCCTGGCGTGAGCACGCACTTCTCAGAAACATTTGCGAAAT
CCTTCACATGAAGGAAAGGAGCTGTAGATGCCTCCTTCTGAACTTCGTAAAACGCTGCCACCAGAGCGTTGTAGCTTGGGCACTCGGAGAAGGCTTTCTT
GACAAAGGCAAGTGCCTCCTGCTGTTTCTCCTTATCCTTGTAGTCCTTGTCCGTCATGAAGGCGTACGTCAATCCCATCAGGATAGATTTTTCGGCCAAG
CCAATGCGGAGCTTACCCTGAAGACCACGGATAATGTACTTGGCTCCCTCAGCAGACTGCGCACCGTCGCCTTGGGCCTTCTTTTCCTTCTCACACTTCA
CCAGCAAACCCTTGATGATGGAGCATTTTTGCTGTTGCGAGTTGTTCCCGGTCATCTTCGCGATCTTGACGAACTGATTGTACACATGCTGGACAGTGAG
ACCGCTGGCTTTAGCAGTTGCGGGTTTCATAGAGGCAAAGGAAAGCGTTTTCTGCTTCGATCGCGCATTCTGCGCAACCTTACCGAGATCGCCCTCCTTG
TTGTACATTTCCTTGATGAACTTGAGGTTGGCACCTGTCGCCTCGCCAATAGCCTTCATCAGGATAGCGTCACCAATGCCGATCTTCAGGTTCTCAAATG
GGGGCGCCAAGTCAACGCACACGCAGAGGTAGATACAAGCCAACAGATCATCCGGAGAACGACGAATGACGTCACGGAAGAATGCAGTGAGCAGGTCTTG
GATGACGAGACGGCCTGTGACTTCTTCAATCTTGGCAAACAAGTGCGCCAGAGCGAAATACGGAGTCTCACGGGGTCCGTCGCTCTCCTCTTCCTGTTTT
TCAGCTGCGTTGGCCTCCTCTTTTTGCTCACCTTGCTCTTCGACTCGGACTCCGTCCCACTCTTTATTTCTCTGTCTTCTTACCGTTAGCAGGAGTCGTC
TTGGTATTCTTCGCAGCTTGCAAGGAGAAGAAGCCAGCTTTCGTCGAAGTAGGTGACAATGCCTCCTTCTTCGTGTCGGTCTTTTCAGACGCTTTCTTCT
GCTCAACCTCTTCAACTTCCTCTTCTTCAGCCTCCTTCTTCGGCGTCTTCGTCTCCTTCTTGGGACTCTTGGTCTTCACTGGCGTCACGGGCTTCGTCTC
TTTCTTATTGGGACTCTTTTCCTTCTCAGGTGACGTCATGTCAATCACTTCCTTCTTCTTCTCCAAGGCCATGGGCAGATCCATGTCGCTGTCTTCATCT
TCCTCCTCTACGATCCGTTGCCGGAGACGACGACGACCAGCTGCAACAATAATAAAAACCGAACAGATAATCAGCCACGGCCATATACCAGCAGCAAAAT
AAAGAGATCCACGTACGTTTCGTCTTGGTGGCTTCTTCTTCATCTTTTTCGTGTTCTTCTATGTGTTCTTCTTCCTGCATTTCGACGTCCTCGGGCTCTT
CCTCCATTTGTTTCTCTTCCTCCCCGTCTTGTTCTTGTGCCTTCTTCGCTTCTTCTTGTGTCTTCTTCTCTTCTTCTTCTTCTTCTTCTTCGTTTTGCTT
CTCTTTTCTCTTGTGGCTTCTCTTTTCGCCTTTTTCACGGGTTTATTGGCGGGTTTCTGCGCCTCGTCGTCCGCCGGTTTGCGCTTCTTGGGGGACGACG
TGGGGGCCCCCGCGCCGAAGAACGACATGATGGAGCGCTGCGTCTTGGGCGCAGCTAGTGTCACGTGAGCACATTTGTATGTGAGTGAAATGGGTCTCCC
CCAAACAGCCCAAAATATACAGCACCTTTCTTCCCCATTGTCACTCCACGTTCGCTTTTCAGCAATTGCAGCCAAAACTTTTTGGCGCGCTCCAAAGTGT
ACCCATCTCAAGCGGTGTCAATAGGCGGATAGTGGAAATACAACAATCCTATTTATTTGGCGGGAAAGCTTTAAAAAGGGTATCCAATCGTCAGAAATGG
GTCGCAAGTTGCTGGCACTCGTGCCGTCGGCGCTACCGGCGTCCGCCAACCTGGAGCGCTTCCACGCGGATGCGACGGACGCTCCGTTGCTCTCAGTGGT
CGTGTGGAGCTCCCACGGCCCTGGGGACGCCACGCGGACGCGTCAACTCGCGCTGGACCGCGATCGGCACCGACTGCTGGAGCTGCAGCGCGTGCAGCCG
CCCGATGGCGCGCGGAGTTGGTTTTTGGGCAACTCGGTGGTGCAAAATGGTTCCCTCACGCTGTTTTCACCCATGGACGCGCTTTTTGTGCTGCTGGACG
CTGCATGGGCCCAGCGCAAAAGGTTCTCGTCGGTGTTTGACCTTTTGGCGCAAAATGGGAACACATGGCTGCTGCAGCTCTCGACACTAGACCAAAAAGT
GCTGGAGACGATCTGCGACGTGCAGACGGTGGGAGAGAAGACGGGGTGGACAACCTCTATGTGAAGGTGAATGCGGGTAAAGTTACAGGGTGGTTAAGGT
CCAAAGTGGAGAAGGTGGCTGCAGTGCTGGCCACGCAGGAGAAGACGGCGGCCAAAGGTGACGCGTTCGCGGAACAGGTAAATGTACCAGGACAAGAGGG
AAAGAAAGAGTGTGCGGAGGTGAAAGAGGAAGTCGTCGCTCGCCATTATCGCGAGGCCATTGGCGTGGTGGGGAACTACCTCCCGGAAGAGTGGATCGAG
CTACTGTGCAAAGAGTTCAAGTACGTTGATGAACAGAGTTTTTGTGTTTTTTGTTTGTTAGCTAAACGAGTTCTATTTGTTGTTCTTAAGGGTGGAGACG
GAGGTGGCGGTGAAGACTCCTGCCAAGTCGGCAACTGGTGCCCAGGACAATTTCAGGCGCTTCGACCGACGTCAGACACCGAGAGTGGGTCCAAGCGCTC
GACGCCTGCTACGGCTGCTGCGACCAAAAAGAAAAGCAAATTGGCTAATGTGGATCGCACCGGAATGAAGTCGCTGACCTCATTCTTCGGCAAGAAGTAG
AGAAGTTGCAGTTTTCGTTGCATTTCGCAGATATATAGAGCTGTTTATCATCTACCGTCGCGATGTCGAGCCCTCCACGCTCACCCGGTGCACTTGCACG
AAATCGCCCCAGCCAGAGAGGATCCTGAACTTGATAAAGGAGGCATCCGTTGGCTTGACATTTTCGCTTACAATTTGCATCTCTCCGTCGGTCTCCTTGA
GCTCTGGTAATGGCAACCAACCATTAGCTGTAGAGCACCAAGACAACCACATGATTTACTCACTGGCATCGAAGAGCTTCTCCCATTTGGTCGGGGTTGG
TCCACTGCAGGCTTCTACGGACACCTCCTTGACATTCCGCGTCCACATCTTGGCACGAACTACAGAAGCCGTCGTTGCAAGCTGAACCACGAGTTCCTGA
GGAAAGCTTCCTGTCGTCACCCACTTGGACGATTGCTCTCTGCAACAACCAAGGCAGCAAGGTTACAAAAGTTTACAAACGCAGAAGCAGGACACACCAT
ACCCGTCCAAGATGTTGACCGGTGGGAAGTTCGGATCATACGAAGTCACCGCCGTCACCTGGGCGCCCTCTTCATCCAAAGCGAGCTCCATCGCGACCGA
GACGACTAACAGACTTTCGGGGAACTCGGCTCTTGTGATTGTGGTCTGCCTTCTGTCCTAAAAACCGCACAGCTTAAACTTAGAACGACGCCACAAGAAC
AAACATAAGAATAGCTTGGGACGCACTCATACTTATCATCTCCATTTGCACAACGCGGAATGCACAGGCGACTTTTACTTGAAACACCCTCCTAGATACC
GACGTCGCAGGCCACAGCGGGTGGCTTTTTCACGGTTGCTCTGATGCTCCGTGAGCTTTTCGTCTGCAGTCGCGGGCTCTAAATCATGTTGGAGGCTGCC
CAAAACCCAATTCACTGGACAACCGCCGACCTACTTACGTTGTCAGCGGTGGCTCAATTGACTCCTTGTACAGCCTCTCGAAACCCGCCGACAAAATGTC
GGCTGCACGTGTGATACCCGATCCATCGTCATTAAAGAGCTTGCAGTTCGACCACATAAGGCGAATGTCGTTGGCAAAGTGCGTAGAATCAAGCTCCTTG
ACACCAGCCGCCACTGTGTTGCTGTCCACAATGTACGCTCCCTTCTTCAGCTTATCCTCGATTGTCGACAAGTCCATTGGCTGCTTCACCACCCGAGTGT
ACATCGGAATGTTCTCCACGGGCGTGAGGAATGGCTTTGAAAATGGATGCGACTTCAGACACGTGACAATTTTCAGGCACTTGTCCAGCAAGCCTTGCTC
TGAAGCCACAGCTGTGGAATACAAATCGAAACGAGACGGCTTCCGACACTCGGCGCATTGCCAATCCCCCTCCGGTAAGTCACTCTCCTTCATGTGCAGA
CACTTTAAGTGGAAGGAGCGCGGGCACTTGTCGCAGCACACCAGATCACCAGCACCCTGACAGACCTCACAGAAATCCAAGTTCGTGTCCAGCTCGCTAT
CTGAATCATCGCCCTCGTCTTCATCATCTTCGTCGTCTTCTTCGTCCGCTTGGTTGTACGTTTCATCCTCTGTTTCTTCTTCGTCTCGTTTCACTCGCTT
GGCATTCTTAGGAGGTCTACCTCTTCCCCGCTTTGGGGCGGAGTAGATTTACGCTCTTGTAGATTCTTCCTCTCTGCACGAGGACCAACTGAAACACTGC
TCGGTGTATCGTTTTTTAGCTGGCGCGGGCGACCTGGTCCATACGCTGGTGATGACTCCGCTGAACGACTTTCCTTCGGATGACGTTGACGAGCAGGGCC
GTACGCCGGTGACGATTCCGCTGAACGGCTTCCCTTAGATCCCGCCTCGGCTGTGTTTGCCTTCACACTACCATCTAGCTGGGATGCAAGTTTTGATCTT
GCATCAGGCGGATATCGGTTTTTCTCCTCATCGTTGTGTTCACTAATAGAGCTTTCATCGCGGCGCGCTAACCTTGAATCGTTGCGTATATCGTTTGAAT
TACGTGGCGCTGGACTGTCCTCCGCATCGCTTTCGCTTGCTTTCCGCTTCCGTGCGTGGACTTCTTCTGCTGACCGTGCACCTGCACTGGAGCGATCACG
AGAAGTACTTTCGTCTGCCGAGTCCATCGAGCTGGTCGATGATTGATCTTGATATGGGCTATCTGCTTGGCGGCGTCTGTTGGCAATACCTCGTTCAGCA
GTCAACCGAGAGGAAGCTTCCATTTCATCGCCAGAACCTTGATCACCAGAATCTTGCGCATATCCACTGCTCTCCTTCCTAGCTACAATTCCATTCGTAC
CATAGCGTAATTCAACCTGGCGATGGGTGCTATCTTTGCTGGATTGACTGCTGGCACTCAGATCCATCGCCATCGACGAAGGCTCCGTATCTTGGTTCAG
CGTGCTTAATAGATGGACCAGTGACTTCTCTGACTCGGCACAATTCAACACAGTAGCCGCAGTTGGTGACTCCGCTGAACCTTGATGAACAAGCGGCGAG
GCGATTCTAGCAGCAACTCGGGGATCAACAGCGTGCACACTGTCAGCGATCACAGACAGCATATCAGTAGGAGTATCCTTTGCCGCACGCTTGGGAAGAG
GAGGGTAACGAGGCAAAGGCTTCTGCTGCGCTTGCATATTTGGTGGGTAGCTATCACGTTCGCCCGCCGGATACTGCCCGTAGTCGGACTGCTGGGTCGG
TATTTGCCTGTGTCCCTCCCACGACCTCCCGTCCTCAACACCGCGAGCAGAAACTTCACCGCGCACAACGGGTGCACGACCATCACCTTGTGGGGTGGGC
GGGTATTGAGCGTAACGGTGGCTGTCGCTGCTTGCCACATTTGGGGCACCGCTGAACGAAATTCGGCCATCGGGTCCTGTTGGGGTAGCTGGAGGCGCGC
GATTGTCCTTCACAACGGCAGTGCCCCCCTGTCCATTGCGACGAAGCGTGTCCAGGAGATAGCGCTTATACTTCTGGACTTCCGTGACTTTTACCTGCGT
GCACGAGGTGCACGGACATCCACTCGTGCAAACCAAGCAGCGCAGCAGACGTCGGTTGGGGGCAGAGCCGTTCCTGCCCACGAACAACGCCTCAAGCCTC
ACTCTGTAGACACTGCGCAAATGCTCGCGACACAGAGAATGCCCCTCATCCGCATGCGGGCAGAAATTCACGACAGGCACATAGTGGCTCTCGCCCGCTC
CACACAAATGGCACAGTCCCTTGGCCACAAAGTTGGCCTCCTGCTCCGGAATCAAGTCCTCCATGGCCACAGCGAACGCATCGTGCAGTACGGACTCGTC
CAAATTCACCTGTTCTCGGAGCATCTCCTCTACTCGAGGGGCAGCTTCCTCTCTCTCTTGTAGTCCTCCGCCATCTTCCCCTTGAATCCCGTCGACGCCT
CCGGCAGTTGCTGAGACCCTGTAGGGCGTTGTTGCATGACCCTCTCCTGATACATATCCGCTCTCCCCTGAAACCCTGTCGTTCTAGCATGGTACCCTGC
AGTCGTTCTACCTTGGTACCCCGCCGGCCCTTGGTAGCCCGCTGCATCCACTGTTCTCGCCTGCGCGTAACCCGTAGCCATTCTCCCTTGTGCGCTGTAA
CCTGTCGAGCTCTCAGCCACTCTCCCTTGGGGTGGGTACACGGTAGAACGCTCTACCGTTCTCCCTTGGTAGGTAGAGTACTGCTGATACTGTGGGGGGG
TGCCTCCCGGTCCGGGGCCCTCCCCTGCCAAGCCGCGGCCGCTGTGGCAGGGACCACTGGCCCCGACGTAACCGGTACGTAACCCTCTGGCGCCTTGCCC
TTGCTCATAATGGCCTCCATCCACACTTCGTTGGGCGGGGGCGTGAGTCGCTGACGTTTCTGTGGAAAATGATTCACAGGATTCACAGGTCAAGAAAGAA
AAGTTAGACGGGGAGGAAGAGGCCCGTAACACGCCGCTCCGCACCTTGTCCCCGTGGTCGCGAGCCGCCCCATGGTACATGCTGACCGCTTCCTCGCGCG
AGGCGTCGGCTGCTCGTCCAGGCTTCGCGAGATTTGTTGTCACCACACGGTTTTGCCGCGGGTTGTGGACGCGAAAACGCATACATTCGCGAAGAAATAT
GGAATACGCTGTCAAGTATGCGTTTTCGGAGGTACCCATCTCAGAAGCTTTCCTGCTCTGGTTTACTGTGCATACAAGCATCATCGCCAGCGCCGCACAA
ACATTGCAAACCTGGCAGCGTTTCTCC