Description :
From Genome Similarity Track
Location :
contig_78:125972- 126975
Sequence
1003 bases(100 bases per row)
GCCGCCTGGTCCATAGCGGCTGCATCCGCGTTAACTATGGATGTGGCGTCACCCAAAGTGTCCGTGGTTCGACCTCCAAGAAGTTGGATATCGCTATCCC
CGCATTGTTGTCCCTCTGTTCCCACGGCACTGTGGTCGGGTTGCCGTGCCCCCACGCACGCGTTATCCTCACACACACCCCGTCCAGACCCACGTTGAAC
ACATGATGCAAATCCTCTAGCTGATGCTGGATCGTAATCATTTCTTGGTCTGTGGGCCGATTGATTGCTTCGGAAAATTGGCCAAAACGTTCAAGCAGAG
TTCCCTGAAGAGGCGGGCCTCCTTGGTTGTGAGAGGCAAGTCCGCCCCGGCCGGAGCACAAAGCACACCGCCGTCTCTCCATGTGATTGCCACACAAGCT
TCCAGTGTGACTCGTTCGGACCTGTGGGGTAGGCCCTTGTACTCTTTCCATCGCTTGGCTCCCCCACGTCATTCCATAGGTCCAAGTGCTTGATTAGCAC
TTTGCCTAGCGCGTCCAGCCGAGACGCGTTTCTCTCCACCCTTCTCTTCTTGCTCATCTGTCTCATGAGTTTCTTCGATTCTCCAGTGCAGTCCACCAGC
AGACCCTGTCTTCCCCACGTAGTCTGTAGTCCATGCCGCCGCCTCAGTCGCGTCCTGACTACCCTCATGTCGTTTGTGTACGTCTCCTCCTCCTGCTCGG
GTGGTGCGAAAGCGAACTCTCCCGTTGTCCATAAGCTAGGCCGGACTGCTCTCTTCGGAGCTCCTCTACAGGGCGTCAGGTGTCTTGTGGGTACAGACAA
TCCTCTCCTTTGTGATAGCGTCGGGAACCACCACATTATCACTCGCTGGAGTTATTACAAGGCAGAAATGTGCCGTAAAATTGGTACATTTGAACTTAAC
CGCGGTTCGTTTGGGAGGTTGGGAATGGTTGGTAGACCCCTCTCTCTCGACAGCATCCCTCGACAGCACGCTGCTTCCTTACCGTCCATTTTTCAAGGAT
CAA