Description :
From Genome Similarity Track
Location :
Scaffold_7:1259199- 1263456
Sequence
4257 bases(100 bases per row)
CACGATCACGACCCTCGTGATCGTGCTGCATCAACGCACATCCGATTGCGAAGTCGGATGCGTCACACACAACGTGGAATGGGCGATCTTGGTCGGCCAC
CGCCAAGATCGGCGCCTCAGACAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGTCCAAACCCACTCGGCGTCCTTCTTCAGGAGCTGT
GACAGCGGGCGTATCATGCTCGCGTAGTCCTTCACGTACTTGCACAAGTACGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCG
GCCACTCATTGATTACTCTGACCTTCTCAGGGTCAGGGCGGACACCGTTCTTCCCGACGAGACACCCGAGCACGGGTATCTCGCTCGTCCCGAAGATGCA
CTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGAGATGCACCTTGTGCATCTCAACATCGCTCATCCCGTCCACAGCC
CGGCTGTGGACGAACACATCGTCGAAGTAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTCACGCACCTGTTGAAGGTCGCAGGGGCGTTCT
TCAGACCCTGCGGCATCACCAGCCACTCCCAGAGCATGCCGCCCGGCGTGCTCACAGCCGTGAGAGGGATATCGCTCTCACGCATGAGGATCTGATAGAA
CCCATCGCGCAGATCAAGAGCACTGTAAATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCA
TCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGTCGCCCTGTGGCTTCTTGACACAGAACGTCGGAGCACTGTGCGGGGATTTTGATTCCCGCACTT
GTCCAGCTTTGCGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCTGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAATACTTCGTCCCCGGCAC
GAGATCAATCTCGTGCTTGATGCCCTTGTCCTGCGGAAGCTCCGCAGGGATCTCTTCCGGAAGTACGTCCGCGTACTCCCGTAAGATTTCGTAGTAGGGA
CTCGTCTTCAACGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCGCAGTGGTGCTCTCCATGAAGAACT
GCCTCCGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCA
GCTCATGACTGGAAGCGAAGTCAACTCCGACGCTTGCGTCGGAGGGTTAGCGAGAGTCATCTCCCTGTACCGGAACCCGGCACAGGTACGCGTCAAGACG
TTCAGCGTCTCGACGTCCGGCTTCTCCGCCTCCGTCTGCCCGGCAGACATTCCTTGTAGCGTCTCGGCCCCAGGCCGAGACTTGCGCAGCGACCTTCGCA
TGCGCCGTCTTCTTGTTTTGCGGAGCCCGGCTCCGCTTGGTTCTTGACCTCGTCCAGGCCCAGCCGTGGACGGGTGTTCTTCTTGTTTACCACCGGCGGG
TTCGTCCCGCGGGCGAGCGACTTCAAGCCCGGCTTGGTCGCCCGGCGCTTCGTCGTGCAGCCCGGCTGCACGACAGTATGCAAGTTTTTCCGGTGCGGGA
CGTTTGCAACCGTCCGCACCGCGAGCAGCGTCGGCTCCCGGAGCCGACACGCCATCTTTACCTCGACGCCTGTTATTGGCGGAGCCCTCCATTACGGAGG
GTGCGTCGGCTCCCCGAGCCGACGAATCAAATTTGTCCATGCTATCGACTCCCGGAGTCGATGCGACTTCAATACCTCGACGCCAACCATTGGCGGAGAC
CTCCATTACGGAGGGTGCGTCGGCTCCCCGAGCCGACGAATCAAATTCACCCAAGCCATCGACTCCCGGAGTCGACGGCGTTACGTCACCTTGGCTCTTA
TTATTGGCCAGACCTGATCCAATCAGATTCGCGTCAGCCTCCACGGCTGCGGCGTGTGACTCGCCTGCGTCATCCGTGCCCCTTGAGGCCGGAGACTCTT
CCTTATTCGCTGAAAAGCGGGTGTCGACCTCCGAGGTCAACACATTTCCTTCATTAGCTGTCGGCGGCAACGCCGACGCTAGCTGCTCTTGCGCGCGTGC
TCGCGCGCGCCCAGGGCGCTCCGGGACAGCGGCATTAGGCGCTGGAGTTGCGCGCACCTGTCGGTGCGTGCGTAGCGGCAACAGGGCCATCGCTCACTGT
TCCGCTGTCGCGACCGAAGCGCACGAGAGTGCGCTTCTCCCAATCGATGACTGGATCATGCCGTGCAAGCCACGGTATGCCCAATACAATGTCAAACTTA
TCGTCCAGATCCAGGACGATAAAGGTCTCGACAAACTCTTGATTTTCATACGTGAAGCGCACGCGTACCATGCGCTTCTCGGTCTTCACGACAGCACCCG
TTGCCAGTCGTACTTCCAACATACTTCGAGGTGTCTTTAAATCCTCGAAGTCAAGCCTTGATAGACTTCGCAGTCGAACAAAGTTCTTCGACGCGCCAGC
ATCTACCAAAGCACGGAGAGAGCCGCTTGCTCTCATCGAGTTCACATTCAGGATGACAAGGTCAGGCTTGTCATCTTGGTTTTTGCAGTGAGAATGAATC
TCACAGGGGGCTGCAGTCCTCAGTGTCGCGCGTCCAAGATCGACACGCGGAACCGCATTACCAGTAGGGCGCCCCCGCGCCTACTGTTGTCCAGCGTTTT
TTTGTTTGGTTGCGCCAGTGCCCGGCACCGCCGCGATAGCCACCCTGCTGGTGCACGGGGGCCGTGCACTCCCGAGCAAAGTGACCGACTCTACCGCAAC
GGTAGCATTGCACGTTGTTTCCCTGCAGCTGCTGGGGTCCAGCAGGTGAAGCACTCGAGAGGTCCATGGGTTCTGGGCCTCCCGTCCTCACTACCGGGCG
TGGCTGTGGCCTCGGCACATGTGCATGCAGCTTAGCCTGCCGCAGGCTAAACTCCTCCTGCATTGCAAGAGTAATTGCAGCTTCGAGAGTACTCGGGTAC
TCACGGAAGAGATAGGTCTTCACAGGCCCATCTCTCAGCCCCTTTATGAACGTGACGACCTTGGTCGCCTCGTCGATCGGATTGGTCACGATGTTCGAGA
CCAAGTACCGTGCTCTCTGAGCGAAAGCATGGACATCATGCTTGCCCTGCTGCAGGTCGAGGAACTCCGGCCTCGACCGGAACTCGTTTTGCGGTGGCTC
AAACACTTGCCTGAGCTCTTCCTTGAAACCCTCGTACGTGCTAAAGCACGTAGGATCCGAGAGTCGGCGTCCATACGCCCAACTTCTAGCACGTCCGCCA
AGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGATGATACGTCGAGCCGCAATGGCAGTGTCGAGTTCGACAAGTCAACGGAGGAGAGGTTCAC
CCTCTCTTCCGACATAGTTACTCACATTGAGCTTTAACGATTGCGCGCGTGGTGTCGTCCCGGACGACACCGCCGTAGTAGCAGCAACATCGCGTTGCTC
CTTCAGGATGAAACCCAGAGCAACACCGTGTTGCTCTGTCGGCGTTAGCGTACGCAGCATCGTAACTACAGCCGCCTCACCAATGACTGTTGACAGTCGT
TGGAGAGCCTCCCACTCTGGATCCGACAGGTGGGGACAGTCAGCGCGTGCAACGTGAGTTGCAGGCGTAGTGGAGCTTTCCATGGGCACCTCTGTATCCA
TGGGAAGGTTCTCAGCTCCGCGTTCGTGCGGTGACGTACGAACTCAGGTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGCCTACT
TTGGCCCACTACTTTAGCTTACACGTGTGCGCGTGTATGTGAGGAAGCGTAGCCTAGTTTAAATTAGTTAATTATACTCGGGCCTCCGAGTATAGATTAA
TCTAAATAAACGATCCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTATGTTTCTGACTTCCTCTAAATGTAATATTCTAAGATAGG
AACCTGCCAACGGCTGGTTGGCAGAATTCCAATGCTATGCTTGTCGCTCATTGGCTAAGAGATGCTGCTCTCAACCAATAGGAATCCTAAGTCTCTATGG
ACCACCCGTCGTGGTGATCGTAAATGTATGTAGCCTTTGGTGTATCTACACCAAGGT