Description :
From Genome Similarity Track
Location :
Scaffold_1:1259017- 1263127
Sequence
4110 bases(100 bases per row)
CGCTCATGATCGTGCTGCATCAACGCGCATCCGATCGCAAAATTGGGCGTGCCACATACGACGTGGAATGGGCGATCTTGGTCAGCCACTGCCAAGATCG
GCGCCTCAGTCCAGCTCTGCTTGACTGTATCGAAGGCCTGCTGACACTCAGCAGTCCAAATCCACTCAGCCTCCTTTTCAGGAGCTGTGATAGCGGGCGA
TTTTTGCCCGCGTAATTCTCAACGTACTTGCACAAGTACGTTGCAAGTCCCAGGAGCTGCCTCCGTACCTTCACGTTGGATGGCGTAGGTCACTCATTAA
TCACTCTGACTTTTTCTGGGTCATGGCGTACGCCGTTCTTCCCGACAAGACATCATCCAAGGAGGGGTATCTCGCTCGCCCCGATGATACACTTTTTCAG
GTTCGCATAGAGTTTATGTTTACGCATATGCCCTAGCAGTTGACGGAGGTGCTCTTTGTGCACCTCAACGTCAGTCTTCCCGTCCACAGCCCGGCTGTGA
ACGAATACGTCATCGAAGTAGCCCGGTGCGAGGTCACGCACCGAGAACAATAGATGTGTAACACATCTATTGAAGGTTGCAGGGGCGTTCTTCGGTCCCA
TGTGGTATTACGAGCCACTCCCGAAGCATACCACTTGGAGTGTCCACCGCCGTGAGAGGGATGCCCCTCTCACGCATCAGAATCGGATAGAACCCGTCGC
GCAGATCAAGAGCACTGTAGAAAGTGCTCATGGCCATCGAATCGATGATAACATATTTTTGCGGTATCGGCGTCTGCGCCGGTATCGTCGCATCGTTCAG
CTTGTTATAAGCATGAACGATACGCCATCCGCCCTCTGGCTTCTTGACACAAAACGTAGGTGCTCTGTGCGGGGACTTGATTCCCGCACTTGACCCGCAT
TACGACGACTTTAAAAACACATTCGTCGCTTGCCTTTACTTAATCACTCGGCATTGGCCACTGCCGAGTCACACAGTACTTCGTACATGGCACGAGGTCG
AGCTCGTGCTGTATGCCCTTATTCTGCAGAAGTTCCGCAGGAATCTTCCCGGAGTTCATCCTTGTGCTCCAGAAGAACATCGTAGAAGGGACTCGACCTC
AACGAGTCCCTGTTCTGCTCGTCGAAGCGCTGCTTCTTCGTGTTCGCGCTGAGAGTGCTCTTACTCTCAGCGGTATTGGCAGCGTGGAATTGCCTCAACT
CCTCCGCTTCGCTTTTCATCCTTTCGATATCCGAAAGGATGCATATCTGCTCGATGCGTCCATCGTACAGGTCCTTCGCGAAGCGCATTCAACCCATGAC
TGGAAGCGACATCGGCTCCGACGCATTTGTCGGAGTATTCTCCAGCTGCATTGACCGGTACTGGAGACCTGTACGGGTCTGCGTCAAGACGTTCAGCGTC
TCGACGCACGGCGTCTTCTCCGATGTCTGCCCGGCAGACACCGCCCGTATCGCCTCGGTTCCGGGCCAAGACTTGCGCAACTTTCGTCGCTTGCGCCGTC
GTTTGCTCTTGTGAAGACCGGCTTCACATGTTTCTCGTCGAGGCCCGGCCTTGGACGGATTTCCGTTGTAACCGTCGGCGAATTGTTTTTAGCGGTAACA
CGCAGGAATGGTTGCTTCAAGCCCAAATCAGACACCGCCGTTCTCGCCACGCTTACCCACCGGTTGGTCGCTGCCCCTGCAAGTGCTAAAGCCAATCACT
CTCCATCACTTGCCATACAGTCATCCGAACGTCGTACCAGCAAGCACAATGAGCTCAATACATGACGGAACTAAGAATTGGAAAAGCGTGAATGATCAAG
CCCGGCTTGATTACATTCCGCTTCGTCGTGCAGCCCGGCTGCACGCGAGCACGCAAGCCTTTTCTGTGTTGGACGTTTGCAGCCGCCAACACTGCTTGCC
GCGCTGTCAGCTCCCGGAGCTGACGCGCTGTCATCACCTCGACGCCTTTCGACGGAGTCCTTCGTATTTTTTGAACCAATCACGACCGTGTCAACTCTTG
GAGCTGACACGCCGACATCACAGCTACTGTCTGTAGTGAGGACCCTTGTATATCTGATGTGTTAGTCCCCTCGACAGACGCGCCACCGTCACAGTCACTC
TGTGACTTGAAGTTCTTCCATACTTGATCGACCAACCCCCAGAGTTGATACGGTCATTGAAGTAGGAACGTATCTCAAATCTGATTTTCGATTTGAGACA
GACTCAGCGACTGCCTCAGTCGTTGCGACTTGTGAATGGGCACCGCAGGCTGCAGCGTAAGGTGCTGCCTCAACGGTGGGATCGGACGCACCTCGTGGTG
CATGCGCGACACTGACAGGGTCATCGCTCTCTGTCGCGTTGCGTCCGAAGTGTACTGCTAATCACTGGATCATGCCATGCAAGCCACTGCATGCCCAATA
CCAAGCCAAACGTATCGTCCAAATCCAGGACGATAAGATCCTTCACAAACACTTGGTGTTTGTACGAGAAGCGCACGCGTACTACGTGCTTCTCCATTCT
TACGGTGGCACCTGTTGCCAACCGCACCTCCAAAACACTTCGGGGTGTTTTAACTACCTCGAAACTCAGCTTCGGGAGTCTTTTCAGTCGAACAAAGCTG
TTCGACGCATCTGAGTCCACCAAAGCACGAATAAAGCCAGCTCGCTTTGACGTCACTTTCAGGATGACAAGATTTGGCTTGTCATCTTGCTTCTTGCAGC
GCGAATCCCTCTCGCTGGGGGCTGCAGTCCTCAGAGTCCCGTGTCCGTTGTAGACACGCGCGACTGCAATACTAGTAGGGCATCCCGTGCCTACTGGTTC
TGCACGTGTTTTTTTTTATTGTACGCTACGATGCCCGGCATCGCCACGTTGGTCCCTGGCCGAGTGCACAGGCGCTGTGCACTCACGCGCAAAGTCTCCG
GTGTACCCACATCGGTAACAGCGAGCTTGGCCCCAATACGCTGTTAGCGTCCAGCAGGTGAAGCATTCGAGAGGTCCATAGGCTCTGGGCCCCCGCTCTC
ATCATCGGACGTGCCATCCTTGGCACGTTCGCATGCAGCAAAGCCTGCTTCAGGCTAAACTCCTCTTGCATCGCAAGCGCAATCGCAGCTTCGAGAGTAC
TTGGGTACTCTCGGAAGAGATAGGTATTAACCGACCCATCCTTCAAGCCCTTCATGAACGTGACGACTTTTGTCACCTCATCGATCGGGTTGGTCACAGA
GTTCGAGACCAAGTACCGCACACGTTGGGCGTAAGCATGAACGTCATGCTTACCTTGCTGTAGGTCGAGAAACTCTGCTCTCGACCGGAACTCATTCTGA
GGGGGCTCAAACGCTAGTTGAACTCCTCCTTGAATCGCATACGTGCTAAAGCACGTATCATCTATGAGCCGGCGGCCATACGACCAGCTCCTCGCTCGTC
CGCCAAGGCATGACATGGCGAATGCAACCTTGGAGGCTTTGTCAGTTGTATGACGAGCCTTTATGGCAGTGTTGACTTTTTTTCGACAAGCCATCAGAGA
AGAGGCTCGCCCTCTTTCCTCACATACCTGCTCACGTGCAGTTTCAACGACTGCACGCACGGTGTCGTCCCCGACGACACTTTCGTAGCATCAGAATCGC
GCTGCTCGCTCACGATGGATCCTAGAGCAACACCGTGTTGCTCTGTCGGCGACAGCGTACGTAGCATTGTCGCTACGACTGCCTCTCCCATGACTGTTGA
TAGTCTTTGGAAAGATTACCACTCTGGATTTGCCAGATGGGGACAGTCTGCACGCACAATGTGCGTGGCAGAAGCATTTGGGCAACGCATGGACGGATTA
CTGTTCACGGGTTAGTTCTCCACCCCGTGTTCCTATTCCACACGAACGCGTTAGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACGGGCCAACTTTA
AGCCCACTATTTCGGCTTATACGTTGGCGCACGTGTATGAGGAAGCGTAAGCTGGGTTTCACTTGAATTAACTAAACTTTTGTCCGAAAGCATATATTTA
CATAAATAGGAAAGCAAAGCCGATTTCCGGTAAAATGGAGAACTGTTTATTTGTTTTGTTTGGGTTTCCTCCCTATCTAACATTCTAAATGAAAGGTATT
TGCCAACGAA