Description :
From Genome Similarity Track
Location :
Scaffold_260:12590- 16150
Transcript NameFunction/comments
Pytar_ATCC12531fgenesh_masked-par_contig_260-abinit-gene-0.25N-acetyltransferase
Pytar_ATCC12531fgenesh_masked-par_contig_260-abinit-gene-0.24ENSANGP00000001286

Sequence
3560 bases(100 bases per row)
TTCTCGCGGGAAAAACTCGAGTTCAAATTCCTCGAAGGCCTTGACGTAGTTGCACTGCTTGTATCCGAGCCTGATCACCCACGAAATGAGGCCGCGTCAG
CAGTGCACTATTTCCCTCATTCTTCCGATAAAATTTTCTGTACGTGTTGAAGAGCGTCAGCGAGGCCTCGTTGGTCTCGTGTATCTTGCAGTAGAACCGC
GTGACCTTGAGGTCGTTCGTCGCTAGAATATACTTCCGCCATCAGTCGGGCGCCCGCCCCCATCAATCAGACATATTCGTCGAGAGCGCACCGTAGGCCA
TCATGAGCTGCAGCGCCTCGCGCGCAAAGCCCTTGCGACGATACTTGGCCTCGGCAATCATGATCTCAATCTCGCAGTTGGTCGCATCCTCGTCGTCGTT
GAAAAACAAATTCACATCACCGGCCATCCCTATACAGTGCACACTACAGCCATGAGGTTTGCTTATGGCGAAGTTCCCGTTGGAGTTGCTGTACGTACGC
GCAATGGCGTCGTCATTGATGAACGAACTGGTGGCATCGTCGCGTCCCTTTTCCAATACGATGAACGTGCACTCTGAGCGAGTCCATACACAGACACACA
CAGAGCTCTCACACATCAGCTCCTTTTCCCCCCTTTCTCCTTCTATACGACGCACTCTTCGGGTCGTTGCGCCACGTCTGTTGCATCTCCAACTCCTCGT
CCATAGTCAGCGGCTCGGACGCCGTAGTCTCTGTGTATATGCATCAAATCGATCAGCAAATCCACCAGTTAGATTCACGACGGGTCAGACCTCTCCCCAC
ACCCAGTAGATACCAGTATCGTTGCGTACACGTACCTTGGAGCCATGGGTCCGTCATCCACTGGTGGTACTTGGGCACGTGCTCGCGCTCGTACGGCACG
AGCGTCACTTTCTGGCCGATCTAGACGCCCAGAGAGAGCGCAAATCGCAGCACAGCGTCAGCATAATACATCTAATGAATTCGCACGCGCAGTGCACGCG
TAGGGGCGGCTATAATGGCGGGCACGTACGATCACGAGGCTGGCATTGTCCAGCATGCTGCCGTCCGCAGATTGATTTCCACAGGAATTGCGCGCCAACA
CCACGAGTCTTCAAATTTCATTGGCTGAAATTAGTGACAAAGTAATATCGACAATCGAGAAAAGTAATATCGACATGCTGAACCTTCCCTCAACACAAAG
GCTGCAGATCCCGAACCCACGTGAGATGGAGACCGCGATCGCGCGCCGCGATGAGGCGCTGCTGCTGCTGTTTGAGGGGCGATGGCTGCAGGTACAAGAG
CCCTATCATATTCAACTCGTGTATGGGGAGGGTGCAGCATTCAACGTGAATGTATGGGCAATGGCAGGTCGATTGTATCGAGCGGTTGGCGATGACGTCC
TCGGGTCTTCGCGCTTTTGCACGGCGCCACCGCATGCGGAGGCGCGCTCTTGCGCTCCACGGGTTCCCAACAGCAATGCGACTCCGGTAAGCGGGGTGCC
TTTGCGTGATTTACTACCTGTCGATTGACTGAGTGCTAATCTCGTGGTTGAAGCTGCTGGTTGCGAGAAGCTCGCGTTGCAGAACTGGTGACCAAGGCAG
CGACGTCGATGGAAGAGGACGGACAGAGCGACCGCGGAAGCAACTCGTTCTATCTATCGGTGCGTGGCGCGATTGTGTGGTAATGTTGCGCATGTCGTTT
TTGTATGAAATAAGAATCGTATGTGGGGAGCGTAGCTACTCGAAATTGAAAGTGACGAGGAAGCCACCTCGTTAATCTCCACGGGCTTAGAAGGTCTCCC
CGTGCACGGTTGCTCACTGGAGTCATACGTATATGATGATTAACCCGTGTTTGTTGGCGTGCAATAGGGGAGATTAGTCGAGACGTTGACCGGACGTTCC
CTATGCACAAGTTCTTTGCCAGCGACGGAGGCGACGGCCAGCGGCAACTGGGCAACGTGCTCAAGGCCGTGTCGCTCCATGTACCGGACGTCGGCTACTG
CCAGGGCATGAACTACGTCGTTGCCGCGCTGCTCATGCTCTTCACCTCCACTAGGGACCAGCAGCAGGAGCAAATGGCTCCACAGGAGGCCTCGTTCTGG
TTGGTCGTCGCGCTCATTCGACAGTTCGGACTGGACGATCTGTGGCGGCCCAAAATGCCCGGGCTTTCGCGGTGTATTCACCTGTACCAGCAACTCCTGC
GGCGCCACTTCTACGATCTCCACGCTCACCTTAAGAAGATTGGCATGCACCCGAGTCTGCTCGCCACGCAGGTTCGTGGAGATAGTCGGTACACTGTAGA
TGAGAAAGACGGATATCTGATGGTGTTGTTGGGATACAACAGTGGTTTGCGACACTATTCGCGCGCGTGCTCTCGCTGGACGTACTCGCGCGTGTCTGGG
ATCTCGTGCTCGTCGACGGCTGGAAGATGGTCTACCGCGTCGCGCTCGCCGTCACGGAACACGTGCGACCGCATATCATCAATTTGGACATGGAGGCCTG
CAGCGATTACTTTCGCAAGCACCCGCGGCTCGGCTTGGATTCTCTCTCGGCTGACGTACTGCTCTCCAAGGCGTTCTCGTACAAGATCACACGGAAAATG
CTGGTGCAACTGGACGAAGAACGCCATCTCGAGGTAAGCTGCTCATAAGTAGTGAGCCGTTCAGTACGGAGTGAGCTGACGGACTGACATTTCTGGGGGT
GTATGCAGTACCTTCGCCTGCGGCTTCAGAAGGCCCCACTTTCCCACGAGCACTCGATCTTGTTCCCCATGCTAGAAGACGACGGCTCGACGCTCAAGCA
AAAAGAATCGCTCGACTTTATCCGCTCGCGGCTTCAACAGTTTGACGCCGATACGGCCGTCGACATGAACGTGCTCCGCAAGAAGATCGAGATTGTTGAT
CGCACCAACGCACAGGCGACTTCTGTGCTCACGCAAAAGTCCTACGCGCTCAGCGAGGTCACGTTTGCGCTCGCCGAGCACACGAGCGTACAGCGACAGT
TACGCAAAAAGTTTGACAAGCTGCTAGCCCGAGCCATCAACGAGGCGTCTTCGCCACGATCCTCGGCGATCTCCAAGGCACAAGCACGTGTCGACTCGTT
TCGGCTGTGGGCGATCCCGTCAGCTGCGATGGGGTACATGCAGCAAAGCCTCGCAGGTTGCTTTGAGCGGGCTGCTCGTCTCCCGGCAGTCGTGTCTCGG
CAGAGTTCGTCTTCGTCTCTAGGTTCTCCGTCAACGGTCTCAACAGTCTCACTGGAGGAGGAAGAAGACGAGGAGGAGGTCGAGGAGACGCGCCGCAACA
TTGCTCACTTGGAGCTGCTCGTGCCACACCACGCGACCAAGCTCCACGCACTGTTCCGCAAGGTCACGGTCGCCGAGAGAGAGCTGCGACGTGTCACGCA
CAAGTACAAGGTACTGCAGCGCGACACGCAGCTCGCCCAAGTCGAGCTCGAAGAAGCCCAGCAGTTCAAGGACAGTCTGGCCGATCAAATGCTGCAGCTC
ATGCTGGCCACGGAACGCCAGAAGAACGTGACGATGCAGCAACTGTTTGCCCAGGTCGAC