Description :
From Genome Similarity Track
Location :
contig_120:1259- 4306
Transcript NameFunction/comments
g11366.t1hypothetical protein

Sequence
3047 bases(100 bases per row)
TCCAGTCGCCACGTGTCAGAGTACACAGTGCAGCTCCTATGCGCTATGGGATGTGAGCCCCAAGTGTTTCCGTCGGAAGCAGACCTCCGAGCATGGGCAC
CCGAGGACGCCGCTACGGCGCTCCGAAAGTGGAAGCAGAAGCTTCGGTCGGCCTTCGGGGTGGCCGAGGCGGGAGTCAGCCGTCCACCGAACGTCCACCA
CGCGTCGGATCCAATCGACCCGTCCATGATTCTGTTACCATTGGCCCCTGGGAGACGCCCCAGAGAGTCGACCGAGGCCGGAATATTTTCGGCCAAAGGT
GCGACCTCGACGTACTTCCAAGACTCCCACATGGTAACGCCTAGGTCGATCAGTCGTACGGAACGACTGGCGAGAGAGGCCGAGGGATACCGAAGCGCTC
CAACTGCTGGACAAAGCGCAAGTCGGACGCCTAGCTGACGTTACGACCCCCGCGATGACTCATTTGACGAAGATTCGTTCGACGTCGGAGACACCGGGGG
TGACCTGACGGGAGAATGGGCGCGCCAAATTCGTGAATTGAGCGCTGTGGAGAATGACAGTGCGACACCGAGGCTAGAGATCGCGACGCATCTCCCACTC
GGAAACATCAAGCCGTACTTGGGACTCCGCGATAAGAGCAAGAAGTCCATGCAGTGGCTCCGAGCTTTCATATACGAGATGAAAGGGACGCACACGCCGC
CCAACGAATGGTGCATAGCGTTTGAATTGAGCCTCCAACATGGTGCTCTGCACTGGTACCGACAGCTGCCCCGCAAAACGAGGCGCACGTGGAAATTGTT
GAGCGATGCGTTCATCAAGTACTACTGTTCACGGTTCAACCAGTCTGCGAAGGTTCGGTACTATTCGGCCAAGCGAGAGCAGAAGGAGCACGTCTGCGAC
TACCTCAACCGACTCAACGGCTATGCTCGCAACGCCGGAGTGCAGTTTGAGCATGGCGGTCGTGATGCAAAAGACCATGTCGAGCACTTCTTGGATTCAT
GCGAAGACCGAGGTCTGGAAGAGCGTCTGTGCCATGTCCGAGTCAAGAACATCCACGACCTCGAGGATATGATCAATGATATCCTTCGTCGCAGGGAGCG
AAAATCGGGACGCGAGTCCTCGGTCCGCTGTCCTCGAGGACAAGAAGTGGTACGCCGACGCTCCAAGGATTCACGGGACGGCTATCGCCGCGACAGGCGT
CACCGAGAGGACGACCGCCGTCGGGAAGACCTTTTCCGAGACGAGAGCCGTCGGGATGACCAGCAGTACCGACCGAGGGTCACTCTCACTGAAGCACTGA
CCGACATGTGACTGCGCTGAATGTGGGACGCCCAGCGGACTCGCGAGGAGGATACCCAGAAGTATACAACGGTGGATATGATGACGCCGAGGAGTACGGA
CCGGAATCTCACTCTGGCGATAACGACCGATATTCCGAAGGGTACTCGGACGACGGATATGCGTCGACCGAGGATCAAGGCCACGTGGCCGCTGCAAACG
CCACTGAACGTCGTAATGCGGCTGAGGGAACGTTCGCTCGCGCCGACAACCGTCGGCCGAGGGCAGGTAACGGTCAATGCCCGTATGACCGAGACGACCG
GCGCCTCAACTCAACCGGACGCGATGGTCGATGCCAATATGGTCCATGCGCCGCCTGTGGAGGACTCACCCATTCACCTGACTACTTCTTTGAGCGATGC
AAGATGTGCAAGCAAGTTCACGATGTCGGAAAGTATGAAGCCTTCCAAGAACTCACGAATCTCTTCCGAGCTAAGTTCGAGAAGAAGGACCTCTCGCCGG
AATTGCAGAAAACTCGTCTATGGAGTCATTTAAACTAGGCAGCCCGCCAACTGAAACTGGGTTGGTCCCAATCGGGCTGCCACGGTTAGCCAAACCTGCG
CTGGACGCGTACTATCTGTTCGCATTCGCAGGTGTGTGCAAACGGCCTAATGACGTGAATATGGAATATGTGAAAATGGTGGAAAATGTAAAGGAGAGAG
GCGTAAGCCTCGTGAGAGTGAAGTGAATTGGAGACGTACGGACGGAGACGAAGTGGAGTTAACCGAAGCTTCGATCATCAGCATGGCCAAAATCGACCAT
CCATCCGAGACCTCGGCCAGACGATTAAACTGTTATCTGGCGAGAGAATGGGGTGTGGTCATCCCAGCGGTACGACAAGAGGAAGCGATTGCGTGTCTTT
ATCAAGGGGCTGTGAACGACTCGCGAACCAGGATTCTGCTGGACACGGAGCGAATGTCAGCGTAATTTCCGCGTCATATGTGAAGCGGTTACGCCTGCGC
GAAGTTCCAGACCACGGTAGGAGTCTGGAAGTGCAAGGAATTAACCCAGGGGTGATGGAGACCCGCAGACGAGCACTCGTTAAAGTCACGCTAGGCTGGG
AACGCGTGTACGAATTTGAAGTATGGATTATGGATCACAGTGCAGGAGTAGATGTGGTCCTGGGAACAGACTTCATGATTCCAGCCGGAGTCCGGTTGGA
TCTGTTCCACGGCACTGCGAGACTACCGGACGAGGTAATGGTGCCCTTGGTGAAGTCGCAGAACCCGGCAGAGGCCGAGCCGTACAGCATGCAAGTGACT
GGACGCCCGACCGAAGACTTGTCGGTCCCTGGGCGTGAGTGGCGAGAATTTAGGTTACCACGACGACGGCCGCCTCTGACTACCCATGAAGTGTGGGCCC
GCCGGATTGGAAACCTGGTGCCCACTGTAACGAGGTCTCGACGGGGGCAGCCGACGATGGTGCGACTAACAAACGTGTCACCGAGGATTGCTCATTGCGC
GAGACACGAGTCGGTATTGTTGTGGGTGAAAGGGGGTGACCTGCCGCAAGGAGATGGATACACTCGTTTGAACTCCGCCAAGTATGAGGAGTGGCAAGTC
CTGGCGTACGCAGAGTGTCGAGACGAGACTCTGTTCGCGCGGGAACGCAAACTCTACGAACGATGGTTGGCAGACCAACCACCTGCAGTAGAGCGACGAG
ACTACCTGACACCTCGCGGCATCCTGCTTCGACCATCGGACGACTTG