Description :
From Genome Similarity Track
Location :
Scaffold_3508:1259- 2337
Sequence
1078 bases(100 bases per row)
TACTCTACGCACTACAGCTATTTGGCATTGTCGTGGTTGCAGCGCAAGATGCTGCGTCAATGACAACAGCCGGCAAGATGACAAGCCAACCCGCAGTCCC
ATCATCGGCTCGTTGGGGTCAGAATGGCATCTTTGGTCGTAAACGCTTGAGAACCGATGGCCAAGACGACGACGAGAGAGGGTTTAATATCGCCATCCTC
GGGATGGATTTGATGGTACCAGCCGGAGTGAGGTTGGATCTGGCGGATGGGACACTTTGTTTCCAGGACGAGATGCGGATCCAGCTCAGCGGACGGCGAC
CGTTGTACGGGGCGAAGATGAGGATCATAAGGGCGGATAAGACGACCTGGATCGAGCCCGGAGAAACCTGGGAACTGTCAGATCGGTTGAAGTGGGTGGA
ACATGAGAAACGGTGGGTCACTCGGGGCGCGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCGCAATACCTTCAGGTCACGAACGTCAGCACC
ATCTTGCTCAACCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATTAAGTCAAGACTCATCGACATCCAACAGC
CAGCCGAAACAGGCAGGCTCTGTAGTGGAGCCGAGGAGTGCCCTGCGGGTTTGACCCCCTGACATGTTCGCATGTCTTAACGTACCGGGCGACCCACTTG
TACATGTGGGTCTACCAGAAGGACTGAGAGACCGACAGAAAGGTCTTCTCGCGGCCCAAGTGGCCGCTGGAGGGCGCGTCATGCGCCTCCGCGAGGATGT
CGAACTTCAGATCCTCGTCGTTGGGTACAACCACCCGTGGAGGATCAGTGGGCTCTACCCGATAATAGAGGAGGCCCTCCTTCAACTCATATCGGTGGAG
CCGTGAGCGCTGTCGCGACGAGAGCCAGTCGGACTTCGCGCTCGTTCCGGCCTTAAGGAACTTGACGATAGGCGCGACAGCCTCATCGTCCCGATACGCC
ATGCGTATCCGATCATATAGATCCGTTGTCACCCGCGTGATGTGGGCCAACTCATAGTCGGGACGCCTAGAGAGGGCG