Description :
From Genome Similarity Track
Location :
scaffold_83:12589- 14119
Transcript NameFunction/comments
Pl_110177phosphatidylserine synthase

Sequence
1530 bases(100 bases per row)
GCCCACTGGGACGTAAGAAACACGAGAGGAGTGAAAGAGGCCCAGAACAGCACGTCGAGATAGCCCCATCCAGTGACGAGCCCACGAGCGCGTCGAGATG
TAGGCTGGTGTGGCACGTTGCGGAAGAAGAAGAACATCCAGATCGAGAACATGATCGCGAACGCCACGATCGGATACATCACGAGGGGCGGTGGCGGCTG
TGTGAACAGCACTGCGTCGGCCGAGAACTTGACCCACACGAGGATCTCGAAGGTCGCGAGGGATAGGATCATCCACGAGTTCTGTCCTAGACGCCAGCAC
TCGGGGTTCGTGATGAACTCGTAGTACTACAATAGACATGAGTTTACGTGAGACACCAGTGTACAAAATGTAAAATGCAGCAGACGAACCTCAGCAGCCG
CGGGGATTCCAAGTAGGAACATGAGTAATAGGCGGTATGAGTTGAAGTTGCTCTCCTTCGGAATGCTTAACGTTGTCAACATGAAGAACGCGTTGAGCTC
CGTGATCAAGCACAGCACCATGGCAAATACAATTTCTGCAAAGCGCTTGAAGCTCGAGAAGACCTCCCAGTGATACTGTTCCCAGCTAAACGGCGTGAAT
TGGTTGAGCGCCAAACGGAAGTAGCCCATCTTCTTGCCGCGACGGCCCGACCAATCGTACTCCTTCGACTCGAGCATCCATAGTGTCACCCGACCGAGGC
ACATACCCAGCATATTTGCACCAAGTAAGTCTAGTAAAAGCGAGTCCCACCTACAATTTACAACGCAAGGTTAGAATTAAAGTACTCGATCTCTGTAAAA
AGTGTCAACATACCAGCACTCCTGAAAGTCCGGAATGACAAACTGGAACGCAAGCTCCAAGATCTCAAAGGCGATGCTGAGCACCCAGCAGAAACGCCAA
TCACGGAACATGCACATTTTGCCCCACCAGCCCGTCACATGAGCAAGGAACCAGATACTCGTCACTCCACGCGTCAGCGACTGCAACATCAAATCACCGT
TCATGTCCACGTTAGTATAAAATCTCCCATCTTACTGTAAACTCGTCTCTCACCTCCACGTTAATATCGCACTGCAGCTGTGCTGGAGCGACAGTCTTGG
GGCGACTGCCGACCTCTGGAAACACATATTGCATAGCCTTCATCGCGCTCACTCGATTCTGCACCAGCATCGCCGCCAGTAGCAGCAAATAAACCACTGA
GCAGCCATGCACCACTCGCCACACACCTGGATGTGGCCGCATCATGAGTCCGTCCCTGGTTTGTAAGAAGCAATAGACCAAAAAGATCAAAATGGCAGCG
AACAGCGCCGTCCGAACGTTCTGCACCGCGTCCTCTGAGTCGTGTGTGAACGAGTAGTAGGAGAAACCGATTACCACAACCAGCAACACGAAGATCTGAC
GCGGCTGCTCTGGAAACAACAGCAACCCCTCCACTTCGCTACCGTGCGTAGCGCGAAACGTGTTGTACGACCAGCTGTCGGGGCGCGGACTAGAGCGCTG
TGAGCCTGGAGACTTCGCCACTCCATCGGC