Description :
From Genome Similarity Track
Location :
scaffold_51:125872- 128464
Sequence
2592 bases(100 bases per row)
cATGAACGAGCTCTTTCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTCaggtatcttgtgaagtggcgggcaTATTCCGACCCCGAAAACtcatgggagtttgaggcgtcaCTTCGGAAAGATTGc
tcagtcgccgtggacgcttttgatcggaaagatcaggacgtcccgcgttaTCAGAcgtcccgcgcttcccggcaatagccagggaagtagaagggcgacg
agctgagctcaagcagtgaccttgagctcttgcggtcgaagacacagagctcgcaggagcattaggggttgtgaagtcatacgtcgcagagcgacaatcc
gaaggaagtcgacggcttGTTTtaggtttggcaaactcaaagcggaggtgtcgctccacacgcacgtccacttccttgtggctcaactgcaggttatgca
gtgaggaaagttttcggtaccgttgcacccatcgctcaaagagcgcttcgtcatctgtagtgctttcccaggggcgagcactacaggtattgtccgcatt
gcgggtacacaagATCcatctcgttgagcacttagacgagtgcaATAAACGTTTGCCGAAATCTCTTGTGGggtcaagaaacgagctcgaagaccttTTC
ATGTGGCAAGTGCATTATCCGTTCTGGTCGGGGGCTcgttgatgtggacgcgtaacgatcgagttaccgcgtccttcgcttccaaagcgggatccgcagg
gagaaagccatattccacacgagggtcaatgaccgaccgtgaatgggcgcgctttagagccgccttatgggcagcttcaagctgccgcctctgtttccCG
TCGTGGTCATTGgttattacaccacgttcctcagctGATAAGAAGTCATGGAGCGggcatggggtccgcaaggggcgagcagggctcgtatcacgctgct
ggtgcagctcgccttcctcgtcatccctcCGGGAAAAAGAGGTGTcaaactcatagtcgaccacatcttcaacgaggccactcggcactgaaagcgtgcg
cggagtgcgacgtttgtgctcttcgagcctaGGGtatacatccctcggtgcttcggacgcactgtccgacgctGCACCGAGTGtgggagatgaagttggg
ctctgcgtatgctcgccgtcagaaccggcgagacttggagattttggtgtcattgacacagggctcattgagcaaggaagttgtttgttccaacaaattg
agttgcagtgtctaacggacacgcgagcctcgttgaggcataaatcgattggaactgtaaatgttctcaatcttaatggggggggATTAACGGaattaca
cgaaccctgataacaggagTGTGTGtcgcacgagatgtgcatggtgtgaccacacccaaacaagaatacggtacggggttATCTCGGTAGTACACGCATG
GTGGGTCTCTCGTCATTATATCGTGATATCGCTTGGACTGAAGAAAATGAACGATCCGTAGAATCCTTGTGGGTAGATGTCAAACTATTTGGACTCACTG
CGCTACGATTGTCTTCAACATGACGGATTCAGAGCTCAGCTTCTTCCCTGGTGCCAGCCGTAACGCTTTTGTGATCCAACCGTCTGAATGTTGTGTGCAT
ATCCCAAAGAATGATCCCTTTTGCTCTATATAAACTTCTGCCGTAAGGAGTGAGGGAGCTGACGAATCCAATGAATACTCCCGTCACTTCATTCAGGGAA
TAATTTTATGGTCTTTGTGTAGCGAAATGTCCGAAATGTGGTACCAAGTCTTTTCTTCACTAGAATTCACTGCTCCGCACGGTAGGTCCCGTACCGAAGC
AGCAGCTCAGTCACTTCGTGAAAAGTCCTCGTCAACGTCATATATTGGCGCTTCTACTCGCGATTTACAGTCACCTTTTGTTTCCAACTCTGTCGCTTCT
ACCCTCCATCGGCATTGCTAAAGGAGATAACAACTCACAGCTGGTCTTTACCATCCGGCCAAATACAATTCGATAGCCACAAATGTCAGTCGTCCTTTCT
CATTTTAGCAGAAATTCAGTCTACAAACCACGACATGTAATCGCTTTTCGTCACATCCTAAGACCAAGATTTTGCTGCCACGTCTGCCTTTTGATCTTTG
CTTAAGGCACCTGGCGAAGTCATGTGAATTGAATAGCAATGGCGAAGCCATTGCtattcaattttaaacagaCTAATGTAATGCGCGGATGCTATCACAG
GGTGCAAACGTCGGAGTTTACACCCTATCAACTAATCAAACTTGTTCCACCCAACCTTACAAGTAATAAGATGTGTCTGATCCGTTGGCTATACGTATCA
CACAATCAGTaaacgacgtcaccatcgtaaTATTTGACAGCTCAAGAGAGATGCGAAAACGCATTCACTAACCCAGCTCATACCTGACCTCAAGGTATGC
TAAATGGTGACGACGTACGGGTATGTGTAGTTTGTACGTATATGCGCCTGTTGTAAAGTGTAGTGTTTTCAAATTGTGTATATATGCTTATG