Description :
From Genome Similarity Track
Location :
Scaffold_39:125851- 132014
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012026Protein of unknown function
Pytul_DAOMBR144PYU1_G012025Protein of unknown function
Pytul_DAOMBR144PYU1_G012024Similar to cdc5l: Cell division cycle 5-related protein (Nematostella vectensis)
Pytul_DAOMBR144PYU1_G012023Protein of unknown function

Sequence
6163 bases(100 bases per row)
CGATAATGTGGGCTAAAAGAGATCCGTCACGTCGAAGCATTGACGATCCTTCCTTTGACCCGTTGACGGCATCTAAAGGTTCCTGCTGCTGGTAGATCGG
TGTTTCTGACAAGCTAGAAGTTGTTAAGCATGTCAAACGAAGTGGTATCATCGAATCAGCTGCACCCGAGGCTGCAGACTCGAAACCTGCAACGCAAAAG
TGTTGGTATCTGACTATTGTACACAATACGTTTCCTGCAAGTGGTTGTATGCGAGGGTACATATGTTTAACCCAGGATATTGTAGCTCATGCCTGGAGTG
ATTGCAGTATTTCCTTCAGTACTTTCAGCATCATTTGCCCCCATCCGCTGAAAGCTTCACTCAAATCTTGGATACGATGAGGAGGAATGCCGCATTGAGG
GTGATGCAGTTTAGCAAAAGCTGCACGTGCCATCGTGACGACCAGCTCGTCTTTTTGCTCTTTGTCCCCTGCGCATTGCGTCTGTTTCACGTGCGGGGTG
AGAACGAATGCGATGGTGGCGTCTTTGCGTACTCTCTCGCTTGGTGCGTACGGATACAGCGCATCGTCGTCCACGAAGTCCACGATAACAACGCCGCAAG
GACCGCCACTGGAAAGCTCGTGGTGGTCGTAATACTTGGAAAACATAATGACATTCGACTCGATCGGGATCCCGTTCGTATCGGACACGAGCCGATAATT
GTAGATACTGTCGTCGATGCTGTCGTAGTCTTCTCGCACCGTGATATACCCGAAGCGCTCGGAAATGCTGATTTCAGCATTCATCATGTAATACAGCAAT
GTATCGAAGACTTGCTTCACGCTCTGAACACCGTGCAAAGGCGTCGAGTCGAAACGAGAGCCGCACTTGTCCCCGTTGGCATTCTCGCATGCGTCACCAG
AACCGTGGAAGCGAAAGGGATTAAGTAGTTCGGACCGCGCAGCAACGTACTCGTACGCACGACGCAACTTGGTATCTTTCATCGCGCGTAAGGTTTCACG
GCGTTCATCCCAGTTTGCACCGAGTCGAATGTACGTTGTGAGTGGATTAGACGCGTAGGCATCCTAGGTGTTAATTAGATGCCACACATAAAAGGTAATA
GCACATCAGGGAATTAGGTAAGTGAAGCAAGCACATCGGCTGCGCTATTGAAGCGAGTCTCACCGAGAACCCCGCAATCGCCGCCTGGGTCTTTGCGACA
GAGAGTTGCTGCGCATGGACAACCTCCTGCATGACGTCGTTCGCGAGTATTTTCTCCGTCACGCAAATGTCTGAGAGCCCCGCGCGCTCCTTCAGAACCT
CCAATTGCGACTCAAGCGTCTCCACATTTTTCAGCAACGACGCTTTCTCTTCCTAACGTTTCGTGTGTCGTTTTTCACATCCACAGATAAGGAATCACAT
GTCAGTACTGCGTTCACAAAAGATGCCGTACGCTGTTTTGGCACATTTGATGCGTACTTTCTGAATAAGGTAAGTCGCCTTGCGGGATTTCGCAGGGCCA
AGTTGCGACTTCAAGTCTGCTTGCTTCTTGGACACCTCGTGCTCCGAGTCGCTCGATCTGGTTTGTCTGCTTTCGCTTTCCGACGTGCCGGGACTCACTG
TGCGCACTGCGCGGTCATCGGGGGCGCTCGCAGCGGGGAGTTCGCCAAGAAGCAGGTCATTGTAGCGGTCGCTCTCGTGTCGCAAGTCGTCGAGAGACGG
GAGCGCGGATTTCTGCGCGGCACTGTGCAGCATTTTTGCTGCCCTGTCGTTTGCTCAATGACGTGCTCTTTTGTAAGACCGAGGCAGGAGTGATGGTCCT
TTTTTTTGCAAAGGTTCAGAAAAAATGAATGATGGTGCAACACACATTAGGAATGATGGCTCCATGTAGCTCTCCATTAATGTTGGTGCATGCACCCAAA
ATATACGAAACAAGCAGCACGAGTGCACGATCAAAGCGCGGACGAAAAGAAGTTTTAGTCAAAAGTTAGACCTCGCTGACGTCTCGCGCATGCAGTTTGG
CGATGGCTGCGCACGGCACAGAGAACAGCTCCAGTCCCTTCGCATGGTAAAACATGTTGGAGCGCGCCAATTCGTTCATGATTTTCTACATGAGCAATTG
ATACAAGACGAAAAGCAGTATCGACAAAGCAGATTTGAGTGCTGTTTTGTTTGCGGCAAGTGCATACCTTCATTTTGAGAATCCGAAACTCCTCAAACTT
GCTCAAATGGTAGTCGATAAGCGCGTTCACGTTTTCCACGCGGCGCTTCTGGTCCGAGAGCATACGCAGCTTCTTTTCTTTTTCCTTTCCCGAGCCACCA
CGCTGCATGCACAAACACACGTCCGCAGTTACTTGTACGCACTCACTTAAATCAGCCATACCCATTGACGATCTTTTCACACCACTCGCTCTTCTCACCT
TTTCATCATACTCTTTCTGTAGCTTGTACTCAATCTTGAGTGCTTTCTCTCGATCTTCTAGTAGTCTCTACGCAAACATCAACAACTAGCACATGTGAAA
GCTTCATCCACCACTGACGCCAATATCAGCATATCACCTTCATAGGCACGATACCCCAGTCCTGGATCTGCGTGAGCGCGAGCAGCATCTCGCCCTCGGG
ACGTTGCAGCATCACGTCATGGGTCTCGCTCGCGAGCCTCTGGCCGCAGTCACCGAGACTGAGTAGACACTGCGCGAGCTCCTTCGAGTCCTCCTGCGCG
CCGATGTCCTGCAGCGCCTTCGCAAATCCGTGGAGGAAGCCCTCCTGCTCCTCGCGCATGCGCAGCATCTTGGCGATCAGCTCCTCAAGTGCCCGTCCAT
TGCGCTCCATGAACTGCAGCTGCGCCTGCACGCGCTTGCCCAAATCGTCCATCGTGCTTGTATTAAATATCGAAGAGCTTCATGCAGATAGATAGAGAGA
TTGATCCATAGTGGTACACTGTACCCCAATTAAACCAAACTGAGGAGGCAAAAAGAAATTCTGATCCGGATAATTTACCATAATAAATTCTCGCCAACTT
TATATAGTACCCCTCCCATGGAGTACTATTTAGTATAGAAAGGTACCACCGCACCTTACGAGTGTTTGGGAGGCGGCAAAGCAACGGAAAGCCAAAGACG
CAGGAAGGCGATCTCTCTCTCTGTATAAAGCGCCGACGCGTGTGACGTGACGACGCACGAGACACACTCGCGCGCTAGACCCCCTCCGTCCCTATCGACA
AATTCCTTCCTCCCTTCCTCCTCCTCTCTCTCTTTTCTATTGTAGCTTTCCCCCTTCTTTCCCGACAACGTCGACGACCACCACCACCTTTTCGCCAAGA
TGCGGATCATGATCAAGGGCGGCGTGTGGAAGAACACGGAGGATGAGATCCTGAAGGCGGCCGTGATGAAGTACGGCATGAACCAGTGGGCGCGCGTGGC
GTCGCTGCTGTCGCGCAAGTCGGCCAAGCAATGCAAGGCACGCTGGTACGAGTGGCTCGACCCGTCCATCAAGAAGACCGAGTGGAGCCGCGAGGAAGAG
GAGAAGCTGCTGCATCTCGCCAAGCTCATGCCCTCACAGTGGCGCACGATCGCGCCCATCGTCGGCCGCACGGCCGCGCAGTGCATGGAGCACTATGAGC
GCTTGCTGGACGCTGCGCAGCAGAAAGAAGGCATCGACGTGAGCGACGACCCGCGTCGCTTGCGCCCCGGCGAGATCGACCCGAACCCAGAGAACAAACC
GGCGCGTCCTGACCCCGTGGACATGGACGAAGACGAGAAAGAGATGCTCTCGGAGGCGCGCGCGCGTCTGGCGAATACAAAAGGCAAGAAGGCGAAGCGC
AAGGCCCGTGAGAAACAGTTGGAGGAAGCGCGCCGACTCGCTGCCTTGCAGAAGCGCCGCGAGCTGAAAGCAGCCGGCGTCGTGAGCAACAAGACGCACG
CGAAGAAGCGCAAGTTCATGGACTACGCGAACGAGATCCCGTTCCAGAAAGTGGCGCCTGCAGGTTTTTACGACGTCTCAGAGGAGCGTCACATCTCTGC
AAACTCCGCATTAGACCCGAAAGCTGCGGCATTGCAGTTGGACAAGTTGGACGGTATCCGTCGTGACCAGCAGGAGAAGAAGGAGCGCAAGCAGGATGCG
AAGCGCCAGAAGAGCATGATGAAGTCCAATTTGCCACAGGTAATCGCGGCCGTGAACGAGAAGAACGATCCGATCAACGCGATCAAGCGCAAGCCGATGA
GTCTCCCAGCGCCAGTCGTGTCGAACGACGAGCTCTCAGATCTCGCTAAGCTGGGAATGCACGCCGCGCATGCTGCGGCGTTGGCGCTGGAGAACTCGTC
GACCACGGAGACACGCGCACTGATGGGCGATTACACGGCAACCCCACTGCGAACGGCGAGCACAACCCCAGCGCCAGCACGTGACATCCATGATACGATC
ATGCAGGAAGCCGCAAACCTTGCGGCGATGATGAGAACGTCGACGCCGTTGCTCGGTGGAGAGAATGTTGCCTTGCAAGAAGGAACGGGCTACGCCGGTG
CAACGCCGTCGAGAACGCCCTCGGTACGAAGCAGCATCGGCGACAAAACTCCGCTGCCTTCCTCGACGCGCACGCCGCTCCGTGATGAGCTGGGGATCAA
CCCGGAGCAACTCTATGGCATGGAAGACAACAAACACGCGGAGAAGGCGCGTCAGAAGCGCATGCTCGCCGACCTGAAGCAAGGTTTTGGAAGCCTGCCG
GCGCCGCAGAACGAGTACGAGATCAACATCCCCGTGAAAGAAGACGATGAGAACGATGATCGTGCACTCGAAGAAGAAGACGCTGGAGACCGCGAAGCGC
GTCTCCAGAAACAGCGTGAGTTGGAGCTCGAGCGTGAACTGAAGCGACGATCGAATGCTGTGCAAAAGGACCTACCGCGTCCGACCAAGGTGAAGAAAGC
GCTCATTGACGGTGGACTCGACGAAATCTCCCGCGAGATGTACGCGATGATTGAGTTTGATATCGTGAAGCACCCAGCGGACGTCGATGGCAAGCAGAAG
AAAAGTAGCAGCAAGAAGCGCAAGAAAGTGTCGGCGGTTGCTGCCGTGCCGCAGCTTCGGACGTTCACAGATGCGCAGCTTGAGCACGCACGAAACATGA
TCCAGATTGAAGCGAGTCTGCATGAACGCGATAGTGTTTGGAAATCGGAGAGCCCAAGCACCCTGGAGTCAACGTGGCTCAACGCACAGTCACAGTACCT
GGCGCGTAGTAGTGAAGACAGCGCGAAAGAACAAGAAGGCACTCGTGCGGAGCTCCTGACGTTTGCGAAATCCGATGCAGACCGCATTCGTGCGATCAAG
GCCGAGTTCGAGGAGCTGAAAGAGGTTGAGCAGTTCCTGTCGAAGCGCGCGCAGAAACTGGATGACCGTGTGCGTGTGATCAACGGCGGCTTCCAGCGTC
GCTCCGAGCAAGCGCTTGCGACGCTGCGTCGTCTCGTGGCCGAATACCAGAACGCGCTGATCGAGCACTCGTGCTTTGACGCACTCTCTGGCATTGAGAC
CCAGGCGCTGCAGAGCCGCATTGCGCGTCTTGCCACCGATGTGAACTCGCAACAGCTTGTCGAAGTGCAGCTACAGAAGAAATACGCCGCGCTCGCGCAA
GAGCAATAGTCAGTAAAGTTAACCAAACAGCAGCTAAGCAGAGTCGAGATTGGCCTCCGCGCCACAGCAAAGTGATGACAACGACTTGGACACCTCTTGT
TCTCTCGTCCGTATTTGCTGAATATCCTAATCAACTTGCTACTTTCGTTATTCAAAAACGCAGTCCACACGTGTATTTAATTGAACGATGGTCACAGCGA
GAAGCTCGCAGTCTCAATTCGCCTCGTCGACGAAAAGCGTCGTCTTTGAAGGCGGCGAAGGTTCCCGGCCGATGCGCAGATTCTCGAGCGAGTACTTGCG
ATGCATCAAGCTCACGAGCGTTTTCAACTGCATCCAACAGCAAGCAAGCACGTCACGTTCGTTAGTCTCACATCCAATTGCAAGTGGCTTTATCTGAGAG
AGCTCACTTACCTCGTGCCATTTCGCGGACATGGTTGACTTGTGGGAACCTGTGAGCGCGTCCAGTTTCTTGAGCAAAAGCGACATCTCTTTCTGTGTGA
GAATGTTCAAAAACGCCTGAAGCGCCAAGTCCATGAGCGCGACTTTCTTGCAGAGCAGGTCGT