Description :
From Genome Similarity Track
Location :
scaffold_638:1258- 2366
Transcript NameFunction/comments
Pl_103286hypothetical protein PHYSODRAFT_262310

Sequence
1108 bases(100 bases per row)
TTATACGGTAGGCCAACCGTTTGAGAAATCGAGCTGGTTCCAGCCGAATTTCTTGTCTCCGTCGGCGTATCCGATGCGAGTATCCACTACAACACGAATC
AAAACCAATAGTTTGGTAAGCATACGATACAAGCATATTCTACGAGGAGAAACTTACCGTAATGGTAATACAGCACGGGGCCGTACTTTGGATCGTTGTA
CACACCCTGGCCTCCTGGTCCGTAGACGTAGCCGTGAGACTCGAGCACGACGGTGCCACCGTTGTTCTTGCAATCATTGCCGCTCTTATCGACAAAACCG
GATGTCGCGTGTTTTGAGCGGCATACGAGAATGCGATACTCCTTACCCTTTGCCGGTCTGGTCTTGTCGTAGCCACAGCATGATCCTTTGGAGAAGAAGA
GGTAGTAGTAACCGTTGTACGAGAACATGTACACAGCCTCCACAACCTCATAGTTCGAAGTGAACGCCATTTGATACGCTGCTGAGCCTCCAGCTTTAGT
CGGAGTCGGACTCATCTTAACTTGGTAGATGTCTTGCCAGTAGCTACCAAAGTAGAGAAAGTATTGGTTACCAATCTGAAACAAGTTCGGGTCGATCGCG
TTGTACTTCTTTGTGGAATCGCTGGCAACCCCAATGCTGCCTAGGTCAGTCCATGAACCAGCTTCCATGGTCTTTGAACGGGTAAGACCGATAGCGGAAT
TCTGTGATCCGAAAGAGCTCACCGAGTAGTACAAGTAGTACATATCACCAACCTTTTGTACATCTGGGGCCTGCAAGAAGTATACAAACACTTTAGATGA
ATGGAGAAGTAAGTGCAATTAATGTTGTACTCACCCAGAGGTCATCTTTACCCTTGAGATTGATCTTGGAACCGTCAGGAACGGCAGCCCCAAGATATGT
CCAAGGACCCGTGAGCGCTGGTGCCGAGTGGATGGCAATCTTGTTGCCGGTGGAGAAACGAAAGTAAGTTCCGTCGTCACGGCGGATAATGGACGGGTCG
TGGGCATTGGTGCAGGTGCCGGTGCACAGCTTCGGGTTGGCATATCCGTCAACAAGGCTAGTCACGAGAAATGAAAGAACGAAGAGCGTAAAAAGCAGCT
TCATGGTT