Description :
From Genome Similarity Track
Location :
Scaffold_190:125760- 130050
Sequence
4290 bases(100 bases per row)
GTCTTCGTCCGCCACTTGCGCCATCTGCAGCCGATTCTCGCTCTTCTTGGCTCGCAAACAGTCGTACAGCAGACCTCCACATGACAAGTTGGATGCTGGC
TCCCAAGTTGGATCTTTATAGCCTACCCACTTGACTTTGAACTCGCGTACAGCACGCTCCGTGCTCGTCGACAGTGGTGTTCTGTCGTCGAGGATGGCCT
CGACTTCATATTCACCAGCAACTTGATCTGGCTCCCAGCTGTCCTCAGGCAATAGTTCCTCATCGAAGTCGAGTCTTGCTTCATTAGTCGCGTCTAGTAC
CAACCGAGTGTTCGGTCGACTGTTGAACTCGCTGACAGCCTTGAGTCTCGACACATGCACTACTGGGTAAAAGCGATACCCACTTCGGTCAGGCAGTTCC
AGATCGTACGCAAACTCTTCCACCTTGCGCTTGATCCGAAAAGGTCCATGCCACAGGTGAGCTAATTTCTTCGTCAATCCCGGTTTGACGCGTTCCATGT
ACAGCCACGCCCGGCTTCCAATCTCAAATAGAGATCTCGGTGGGGCTCTTGCCGGGTCTTCCATCTCTTCCGAAGCTTCTGGAGGGTCCGCTGAGTGTTC
GTTTCCACTTGGTTGAGGTACAGCGGCTTTTTCCAGTCGTCTCAGGGCATCATTATGCTTTTTAGCCCTTCGCTCCTTTTCTACAGCCTGATAATCTTTG
GCCATAGTGAGGGCGACCTCATGTTGTCGATTGATCTCACGCCGCCACGCTAGTACGTCAGACGGCTTGCCGAGTCCTGGTTTGAGTGATGACGACATTG
CCCTCAACGTCGACTGAACATCCCAACCGTGAACGAGGTAGAACGGCGTTTCCTTCCTCGTAGTGTCTTGAGAAGTATTAATAGCAAACACTAGATTCTT
CGCGATTTCGTCCCAATCTTGCTGTAGAGGGTCTTCCGCGTACACCCGTACGGAACCCATCACCAACTCTACCGAGCGTTCCTGTTGTCCGTTAGCCTGT
GACCGATAGCTCAAAGTCGCCCGTGATCTTGACTGCATCATCTCTGCAAATACTTGGAACACCTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCTTATCA
GTGGTGGGGCTCCGAGCCGTCGGTACACACATTCTTCGAACACTTGGGCAACACTCAGTGCAGTCGTATCTGACATAGCCTTGGCAATAACGAATCCCGT
AAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATTTCGGTAGTGGGATCACTAAATCCATCGAAACGATCTGGTAAGGTCGTTCGGCT
AGTACGTTGCCAGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACTCGAGCTGCAATCTGGACATGACTTCACATGCTTCTCCACATCAGCGTACAAGC
CGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCACACCTTGGTGCCCACCTTCCAGCGAGTCGTGACAGTTCTGTGGGACCTCTCGAAA
CATCGTTGTCGGTACCACAAGCCGCAGCTTGGTCTCTTTATACCAACCGTGGTCGTACCGACGATTCAATCCAAGATAGTGAAGCACGCCGTCTTCTGAT
AACACGAACCGGTCAGCGTACTTCCAGGCATCTCGAGCTTCTTTGTAACTCAGCTCTTCTGCTTGGACCTGAAGCACCTTCTTGATGTTAGACCACTTCT
GCTCATCGTCTTGTGCCACCATTATCCGTCTGCGTCGTTCACGCTGTATTGATACCGGGTCAACATCTTCCGCATCGGGAAACGCCGCTGGTACAGTCTT
GTGAGGATGGTCTGGCAAATCTTCACCGATTGAATCTTCGGTGGACGCCTCTCGTCGTTCTTCATGCTGTTCTTGAGCTTTTGAGACATCCTCCGGGGGG
GGTAATCTGCAAACCTGACGCGTTTCTTGGCTTTCGTCTGTCGCCGAGTCATCACTGCCATATTACCATAATCGCACTTTGGTGAGCTGTAATCAACCAC
GAAATTTTTGAACATTTTCCACTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACGCTCTGCTCCACGTGACGAAACATCTACCGAGTCTTCATCC
GGTTCGTAGATCATTTCCTGGATGCGATTCAGCGATGCCAATTCCGACTTGCGAGTTTCAGCCAAGATTACCCGACTGACCTTCGATTCCAGCGCTTCAG
TGGCTAACGAATCCGCGGCCGCGTTGTATTCTCGTACAACGTGAAGATATTTAACTGATCGAAGCTTGGCCGTGCGTTTCTTGTGAGTATTCAGCAGCGG
TAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGTCTTGAGTCACCAACGATGACTAAATCCTCGGCACCGTGCGCAATA
GCAGCCTTGACACCGTTTATCATACCTGTATACTCTGCCTCATTCACCGTGGTAGCCGAGAGGTAAGCGTTTGCAGCAATCACTACCTTCCACTCAGGAA
GGCTCCACAGCACCCATGAACAGCTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACATGACGAATCCGCTGTAATTACGGGAAAG
CCTGGCGTACAGCAACGCGGGGTCCATTCGAGTAGTCGGGGAACCTTTGTTTGGAGGTGCCACCGGCGCGAGCGAGTCTTCCAGGTCGACGAAGCTCGTG
ATGCTGGACTGCAGTAGCTGCGCGAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCAAACTGGACCGCGCGTCCGAAGAGAGAC
TTCGACTTATGCACCCACTCTAACGTCGAGAATCGTGTATAGACATGTAGCGTCTTTCCTGCCAGCTGGACGTAACAGATCTTCAACAGCAAAAGTAACG
CCAAAACTTCCTTCTCAGCAGGATGGTAGTTCATCTCGGCCTCCTTGAGCACCCGACCGAGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCAT
TAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGCCTTCGACCGATCGAAGTGCCTGAGGATGGGTGAATGTGAAACACTCGTC
TTCAATTTTACGACGGAACGACGTGCCACAGAAAGGCCACCTTCAACGGCAAAGTCTTTATCCTTCAGCTGGTACGGCGCCACACCGTAGACCGCAAAGT
CTTGAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGCCCTTCTTGCTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTT
GAGGTCAGCCCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGTTGGCAGAAGATGCTCTTGGTGAAGTTAATGCTGATCCGACAC
TGTGCAAATCTTGCCAGCAATTGGTCCAGCGTCGCCAGGCAGCTGCCGAAATCCTCGCCACCGAAGCAAATATCATCCACAAACGACCGTCGACCAAACA
CAGGTACCAGCGATGATAAGTCTGGCTCCCCGTTCGTAAACATGTCAGCGACGGGACTGTTGACGAGTTGTAGTACAGGGTCGTTCTCTACCGGTGCTTT
GCGGTCTGCCGCGAACTTCGTTTGAGACGAACCCTCGGCACTTGACCCACGACGTTCCTCGGCCTGTTCTTCAGCTAAACGCATCCTCTCCGAGTATTCA
AACCAACCTCCTTTAGGTTGAGCGAACCCCCAGAGTGCGTTGTCAATCATACGCTGGTAGATCATCGGCGCGTTCTTTAATCCAAAGGGCATGCGCAACC
ACTCGAAGTGTCCGAGTGCGCAGACAAGCGCCGATACTTTACGTGCTCGCAAGGTCATCATGACCGCCCAGAAGCCGCTTGCTGCATCCAGCGAGCAGAA
CCATAGGTAGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCATGATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAG
AGCCGGATGTCCAGCCCGTTCTTTTTCATCCCAATCACGATCGGCGATGCCCATGGACTATCGGAAAAGACGATCAGTCCTGCACGCAATAAAGCGCGCA
GCAGCTCTTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTTTAATTGGAGCGTGCCCCTGTGTGTCGATATCGCATACCGCGCCGTA
GGCTGGCGGTGGCAGTGCGTTACCACTTGCAATCAGGATCTGCTCGTGGTTCTTCAGCGTCGCGACCAGACGTTCTCGGCGATCAGTCGA