Description :
From Genome Similarity Track
Location :
contig_78:125756- 126759
Sequence
1003 bases(100 bases per row)
GTCCATAGCGGCTGCATCCGCGTTAACTATGGATGTGGCGTCACCCAAAGTGTCCGTGGTTCGACCTCCAAGAAGTTGGATATCGCTATCCCGCATTGTT
GTCCCTCTGTTCCCACGGCACTGTGGTCGGGTTGCCGTGCCCCCACGCACGCGTTATCCTCACACACACCCCGTCCAGACCCACGTTGAACACATGATGC
AAATCCTCTAGCTGATGCTGGATCGTAATCATTTCTTGGTCTGTGGGCCGATTGATTGCTTCGGAAAATTGGCCAAAACGTTCAAGCAGAGTTCCCTGAA
GAGGCGGGCCTCCTTGGTTGTGAGAGGCAAGTCCGCCCCGGCCGGAGCACAAAGCACACCGCCGTCTCTCCATGTGATTGCCACACAAGCTTCCAGTGTG
ACTCGTTCGGACCTGTGGGGTAGGCCCTTGTACTCTTTCCATCGCTTGGCTCCCCACGTCATTCCATAGGTCCAAGTGCTTGATTAGCACTTTGCCTAGC
GCGTCCAGCCGAGACGCGTTTCTCTCCACCCTTCTCTTCTTGCTCATCTGTCTCATGAGTTTCTTCGATTCTCCAGTGCAGTCCACCAGCAGACCCTGTC
TTCCCCACGTAGTCTGTAGTCCATGCCGCCGCCTCAGTCGCGTCCTGACTACCCTCATGTCGTTTGTGTACGTCTCCTCCTCCTGCTCGGGTGGTGCGAA
AGCGAACTCTCCGTTGTCCATAAGCTAGGCCGGACTGCTCTCTTCGGAGCTCCTCTACAGGGCGTCAGGTGTCTTGTGGGTACAGACAATCCTCTCCTTT
GTGATAGCGTCGGGAACCACCACATTATCACTCGCTGGAGTTATTACAAGGCAGAAATGTGCCGTAAAATTGGTACATTTGAACTTAACCGCGGTTCGTT
TGGGAGGTTGGGAATGGTTGGTAGACCCCTCTCTCTCGACAGCATCCCTCGACAGCACGCTGCTTCCTTACCGTCCATTTTTCAAGGATCAACTCGAAGG
TCA