Description :
From Genome Similarity Track
Location :
Scaffold_28:125752- 127320
Transcript NameFunction/comments
Phyca_LT1534115504Hypothetical protein

Sequence
1568 bases(100 bases per row)
taccggcggaatactgcatcatcacgtagggacccataggatatcgtcgatactcagtagttgagagaagagcaaaatcgtattgctgtttcacaagctc
cactgcatgacgagaaacagtattgaggagcgcgttcggctctgagtcatactccacgttcgtataaacaccaatacgtttgatgtttctcgcccaaatc
ttttcattcacagtctgccaaaacagaatcgagacaacacagtcaagggcctggagcgattgaccagggtcttcaacttctgccagcttgactccagtct
agacatcatcaaaaatggattagtatatcaactcgaatgacaaggtatgagcgattctcaccgattgttggtatgatttcccatatgaggaatgtttcct
ctgtacactgagctccatcgctccttacacgacgtccagttttcatcgaaatagtcgaaccaaagccgaaccttttcatccgaccgcaataacactttca
tcgtcgaaataacactgtcgtatgcagcttcagttggtgcactcacaagcaactggatcaatctcttcatctccttcttggtccatgcgtcgagattata
tttttctttggcgacctcttcctgcaagtatttgacagcatgaaagtgacaaattaaaagccttgtaccagggaactcctctcgtagtacagcgagctct
gtgaagtccttatcaatgatgataacagccaccgaatcatgcgacggacagctctccttgaactggcgacacgcaatacgaagagtttccttcctctcat
tctccaccagacagtgctgtacgcatcaaacaatccacaaaccaggttacagcattagattaggtattattctcagttttgcgcacaaacgcagaacggc
acacagtattagaatgtgagccattctaaacttcgatgcaccaacccacctgtacatgctgccccttgcccatggcatcatgtatcatgaagctgaatag
tttgtagttggatgagtttgtgtcgtgagtcgcatcaaagagcatcacttctggaaaatgctcaaacatggttctcatgtgggatgactggagtcctcca
aaatcgcacggattatctcttccatcgtcggaaatgagtaacttatcttttgaagctgggctaccaggttatgaacatccttcatcgtcggttccacaat
agtgtggtccatgatgaattccagaatgcgcttgcggcttgctcctgctcgatgaagtgtttggacagtcgagagaacttcatcgtccgagacctgccga
gcttcgtgatacgtctggtagacatcagggccaacttcatggttatgcccagccttctgtactgtgatgcagacctcccagtttccagtctcacgaacgc
aggcgttaatctacgcatgaattgtttgcatggagaataagtcagttgttatagattcagccatcaaccttcatgcatacctgcgccggacagccaaggt
tccttgattgttggtgagggcgcgtgccttcacttctggtccctctgggctttccgtaatgcgtgcaa