Description :
From Genome Similarity Track
Location :
Scaffold_25:1257305- 1265313
Sequence
8008 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTC
GTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCAGGATGGAGGCCCTGCAGAGCC
TGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTTGACGCGTACGAGCAGGGCCTCATAGTGCATGTGCAGGAGAACCTGCAGGCTCC
GGCGGCGGAAGCAAATCCGTCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAA
GTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACA
CTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCACCAGCG
TTCACGCTTCCTCGCGTGTTAACTAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAAT
GAACACATCAAGATGACTGTGTTCATGGACGGCCTTTGAATGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAAAGGCGATTC
AAGTGGCTATTCAAGAAGCGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTGTCTTGTCGGCTCCCGGTCGAACAAGCCCCAA
CGGACCAGTTTCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGTGACTGCCCCGCGGAA
AGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGGTGGCAAAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGG
GCGCCCTACTGAAGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGCG
AAGAACAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATTCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGTATTTCGCAC
GCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGT
CGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTTTCGATATGGATCCATATGATATG
ATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTGG
TGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCTAGGGCTGCCAGGGTACCAAAGTATCCGGCAGATGTTCGGGAGTCGTCGACGTATATGA
CGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGCT
GCAGCTGTCATGAACACTGAAAACAGCGTGTTAAGAGTGGGTAACAGAGTTCCACTCACGGTCGCTCAGACCATAACTGAAGAGAAAGACGTCGGATACG
CTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCCTCCTGTGTGGGTAACACAGTTCCACA
CGCGGTCGCCCAGACCTTAACTGAAGAGAAATGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCGTA
GCGACGACATCCCTAGACGTGGGCAGCAAAGCCCCCCGTCACAGGCGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGA
TCGACGTCGCTTCAAGCGACCCGGAGTCCAGGGCCCGAGCTCGCCGACAAGGCCGGTGGAAAAGTGTTATCACATCTTCGATGGCGAGACAGGTTTACCC
GTCAAGGCATCTGGTGTCCACTTGGAACCGTTTCCAGAGGTTGCAGAGATACTGCACCTCGAGTAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGG
CTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGATATTACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAA
CAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTACGCGGACGTGGTGAACAAACAC
CCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCG
AGCATTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCG
TAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAGCGCAACGGTGCTGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTG
AACAACATGGCCGGGAGCTTACTGTACAATGCGCTGGATTTAATAGACGGATACTACCAAATCCTGATGCGCGAGAGTGACATCCCGCTCACCGCGGTAA
GCATTCCAAGCGGCATGCAAAGCATGCCGCTTGGAATGCTGAGTGGCTCGTCATGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCTGCGACGTTC
AATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTATTGAGGGAGGCAAGACGG
CCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGA
GATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAG
GATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCTCTTCTCGAGCCTTCTTCAGAAGGACG
TCAACTGGTGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTGCCGGACGAGACGAAGCC
GTTTAGCGTCGTCTGCGATGCCTCCGATTTCGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGAACAGGAACGAGTCATCTCATTCCAGTCCAGG
CAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTA
CGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAACGGCCTGTCGGTGGAGCGGTGTTCTTCGCGGA
ATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTG
ACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCCTTAAGGCCGGAACGAGCGCGACGTCCG
ACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCGTCCACGGGTGGT
CGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCTAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTC
TCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGCGAAACATGTCAGCGGGTCAAACCCGCAGGGCACATTTCGG
CTCCACTACAGAGCCTGCCCGTACCGGCTGGTTGTTCGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAAACCCGGAAT
TTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTG
TTCCGCTATCACGGTCTCCCAGAGACGATTGTCTCGGACCGAGACCCACGGTTCAATGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTAAGAACTCGTC
TGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACAGTCTGCGCAGTGTGTGCGCGGCAGCACG
ACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCTACTTGAACGGCTTCCGC
CACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATCTGA
GACCAGTTCCGCTGCGGAAACAGGTGGAATCCTTTATGAATACCAAGCTGAACATTGTCAGCAGGGTCCACGATGCCATGGCAGCGGCCCAAGATAAGCA
AAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGCACCTACCTCTATACACGGTT
AGCACTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACTTGATGCGTCGTACACCATCGACCTTCCAAGGTCAA
TGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAAGGGGTGGCTGACTCGCAGCTCCCCCTTGACACAGCTCCTCGAAG
CGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCTAAGTCTCGGTCGGAACGGCAAGGCTGCGGCCAAGACCGTACGCCGAAGGGGCTC
CATACGAACGGACCCCGGCGCCATACGCCGGGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGCCGGCTCCGAACG
TGGCAACAAAGCCTCGATCCATCGGATTATTCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGTGCAGGCTCGCGACCTCT
CGCTCCGCCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGTATTACCGCCAGTCCCAAGGTTAAGTGCGATCT
CAAGCACGAGGACACGTTGACGGAGGCGGTCAATCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGGCTCTCGGGAGGCGCCGA
GTACTCGTACTCGTACGAGGGCACCTCTGCTCCTGCTTGACCGAAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGG
TAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCTACTCCGAGAACTCGTGGGAGCCGGTTGAACGGCTTCTGACTGCCCGAAGGCTGTCGCAATCT
GGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCGTACCCGCGCTCATCGTGAGCG
CTAGAAGCCGCGCGCTTCATGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGAGCAAACCTCACGCGAAGATCACGCTGGTCCAGGATGTGGGACA
GCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGTGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAAAAACTCCACGTGGGACA
GTTCTCGGGCATAATCCAGGGGTATCCCTAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCGTACGACAGGTCGTGAAGTCCTTAAGGGGAATGCGG
TGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGATGCCCCTAGAAGTGTGGC
CGCTCGCAAGACCACGAGGAGCGACGAGAACCTCCAAGAAGAGGTCAGCCCCAGAGCTCCCCTCGGAAGGCCAATACCCTCTTGAGTTGATGGCAGCTCC
CTGGCTGACGGGTGCCGCCACCGAACCCTCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTTGAGACCTCCCGGGGCTCA
ACAATAGCACCCTCCTCCACCACTTCTTCCTCTTTCTCCTCCGCTTCATCCAAGGAGTCGAAGAGACTCTGATAGAAGCGTCGAGTCTCCTTCTCCTCGC
GGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGTCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCGGCAAGCGAGAGACGTTT
GCGAGGGTTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAGCGGCCGGACTCTCAGAGCGCACAGAGGGCCTGGGACTGTGATCACCG
TGATCACTAGCGGGCGCCTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTTCCCTCCCACAAAGCCCGCAGGAGCATCATGAGTGCTCTCGG
ACTCGGCATCGTCTTCACTGCCCGAGTTGAGCTCACGTTCTACGAACCGAGGGCTCGGACGATTGTCTGAAGACGAGGGCGACGGACTGCGGCGCTTGTT
TGCGCGCTTGTCCACAGCCGCGTCACTTGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTTTGCCGTGAGGCTTAGTG
CTCTTGGCTTGCGCCTTCCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGTCGAAGTGGAGACCTAGA
CGAAGAGCACACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGTTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAGAG
TTTGTGACGACCACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAAGTGTACCCTGGTTACAT
GAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCATAGCCAACCATTGGTTAAATGA
CATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCG
CTCTCTTTAATTAAAATAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTATGTGACCC
CGTCACAT