Description :
From Genome Similarity Track
Location :
Scaffold_25:1257188- 1265313
Sequence
8125 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATAGAAGAGGGGACCTGTGAACTGCCGTTCACTGAGATTTG
TATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTAC
CTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCAGGAT
GGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTTGACGCGTACGAGCAGGGCCTCATAGTGCATGTGCAG
GAGAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGTCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTC
ACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGC
TAAGAGTTGGGTGTACACTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAAC
TACGAGTACCACCAGCGTTCACGCTTCCTCGCGTGTTAACTAGGAAGGCGCGAGCTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAG
TGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTTGAATGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCAC
CCTTGAAAAGGCGATTCAAGTGGCTATTCAAGAAGCGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTGTCTTGTCGGCTCCC
GGTCGAACAAGCCCCAACGGACCAGTTTCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGC
GTGACTGCCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGGTGGCAAAAGCCAGGATCCCGGGGACAGGGGAACGCAGG
GAACCAGTAGGGGCGGGGCGCCCTACTGAAGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTTC
GCACTCTCGAATCGGCGAAGAACAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATTCCTTTAGAATCTTGATTGACTCTGGGGC
GTCGAAGTATTTCGCACGCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGA
CTGGCCGACGGGAAGGTCGTCACTGTCCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTTTCGATA
TGGATCCATATGATATGATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCA
GTCCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCTAGGGCTGCCAGGGTACCAAAGTATCCGGCAGATGTTCGGGA
GTCGTCGACGTATATGACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACT
TAGTTCCGCAGACAGCTGCAGCTGTCATGAACACTGAAAACAGCGTGTTAAGAGTGGGTAACAGAGTTCCACTCACGGTCGCTCAGACCATAACTGAAGA
GAAAGACGTCGGATACGCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCCTCCTGTGTG
GGTAACACAGTTCCACACGCGGTCGCCCAGACCTTAACTGAAGAGAAATGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGGCCACGA
GTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCCCCCCGTCACAGGCGCCGTCGGCAAAGACGCCGCCGCCGCCTCAAGTCGGA
TCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACCCGGAGTCCAGGGCCCGAGCTCGCCGACAAGGCCGGTGGAAAAGTGTTATCACATCTTCGATG
GCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTTCCAGAGGTTGCAGAGATACTGCACCTCGAGTAAATGACGGCTGAGTCTTT
CCTGACCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGATATTACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAAC
GTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCGGTGTATCCTTTGGTGACGGAGTACGCGG
ACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCA
ATGGCCTCTCCCGCGCGAGCATTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACG
CCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAGCGCAACGGTGCTGGCCCAAACACCAATCCCAC
GAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCTTACTGTACAATGCGCTGGATTTAATAGACGGATACTACCAAATCCTGATGCGCGAGAGTGACAT
CCCGCTCACCGCGGTAAGCATTCCAAGCGGCATGCAAAGCATGCCGCTTGGAATGCTGAGTGGCTCGTCATGTGGCTCGTCATGCCGCAGGGCTTGTCTA
ACGCCCCTGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTAT
TGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGC
GTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGA
CGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCTCTTCTCGAG
CCTTCTTCAGAAGGACGTCAACTGGTGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGGCCCTG
CCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTTCGCCATCGGATGTGCATTGCTGCAGGCCGACACGGCTGAACAGGAACGAGTCA
TCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGT
TCACCTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAACGGCCTGTCGGTGGA
GCGGTGTTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGG
CCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGCTCCTTAAGGCCGG
AACGAGCGCGACGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTGGAGCCCACT
GATCGTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCTAGCGGCCACTTGGGCCGCGAGA
AGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGCGAAACATGTCAGCGGGTCAAACC
CGCAGGGCACATTTCGGCTCCACTACAGAGCCTGCCCGTACCGGCTGGTTGTTCGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGA
CACGGCAAACCCGGAATTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGT
TGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCAGAGACGATTGTCTCGGACCGAGACCCACGGTTCAATGCTGCGTTTTGGAAAACGCTGTTCCC
TTTACTAAGAACTCGTCTGCAGATGTCCACTGCGGACCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACAGTCTGCGCAGT
GTGTGCGCGGCAGCACGACGTACGTGGTCGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGCTCACGCCGTTCT
ACTTGAACGGCTTCCGCCACCCCAGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTC
CCAGGTCTCGGATCTGAGACCAGTTCCGCTGCGGAAACAGGTGGAATCCTTTATGAATACCAAGCTGAACATTGTCAGCAGGGTCCACGATGCCATGGCA
GCGGCCCAAGATAAGCAAAAGGAGTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGCACC
TACCTCTATACACGGTTAGCACTGTCGGCAGCAACAAACTGAAGCACCGCTTCATCGGACCTTTTGCAGTCCTGGCCAGACTTGATGCGTCGTACACCAT
CGACCTTCCAAGGTCAATGACGACGCACCCGACGTTCTATGTCGGACGTCTTAAGCGGTACTTTGACCCGCAAGGGGTGGCTGACTCGCAGCTCCCCCTT
GACACAGCTCCTCGAAGCGAGGGCCGGTCACAGTCGTCGACGAGGGCGTCGGAGCAGGCACCTAAGTCTCGGTCGGAACGGCAAGGCTGCGGCCAAGACC
GTACGCCGAAGGGGCTCCATACGAACGGACCCCGGCGCCATACGCCGGGTACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCC
GCAGCCGGCTCCGAACGTGGCAACAAAGCCTCGATCCATCGGATTATTCGAAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATCCACCCGCAGGT
GCAGGCTCGCGACCTCTCGCTCCGCCAGGTCCAGGCGACCCGCAAGACGAGCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGTATTACCGCCAGTCCC
AAGGTTAAGTGCGATCTCAAGCACGAGGACACGTTGACGGAGGCGGTCAATCTCAGGGTCCCGTGTCGGACCCGCAGTCGGAGCACTCGGACGAGAGTGG
CTCTCGGGAGGCGCCGAGTACTCGTACTCGTACGAGGGCACCTCTGCTCCTGCTTGACCGAAATGGAGAAGTCCACTTCCACGTGGAGCGGATCCTCCAG
GAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTATGCCTACTCCGAGAACTCGTGGGAGCCGGTTGAACGGCTTCTGACTGCCC
GAAGGCTGTCGCAATCTGGGAACAGAAGCGGCGGCAGCTTCATAAGTAGTCCGGGGCTTCTTGCCCGAACGGGGTACGGACGATGAATACATACCGTACC
CGCGCTCATCGTGAGCGCTAGAAGCCGCGCGCTTCATGATGTCCCTTGGCAGCATACGCTTGCTGATCAAGTGAGCAAACCTCACGCGAAGATCACGCTG
GTCCAGGATGTGGGACAGCTGCTGATCTTCATGGAGTTCCCATAACTCCGTGGGTGAGTACTTGAGAGTCTCCACCCACGCCCAGAACATGTCCTCACAA
AAACTCCACGTGGGACAGTTCTCGGGCATAATCCAGGGGTATCCCTAAACAGGATAGAGACCACCCCGGGTCTCGGGCTTCGTACGACAGGTCGTGAAGT
CCTTAAGGGGAATGCGGTGTGGCGCGAGAAGCACACACCGAGCAGCCTCCAAGTTGTCGACGAACAACTGTTCTTTCTGAACAAGGGCTCGTTCATAGAT
GCCCCTAGAAGTGTGGCCGCTCGCAAGACCACGAGGAGCGACGAGAACCTCCAAGAAGAGGTCAGCCCCAGAGCTCCCCTCGGAAGGCCAATACCCTCTT
GAGTTGATGGCAGCTCCCTGGCTGACGGGTGCCGCCACCGAACCCTCACGCACACGCTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTTG
AGACCTCCCGGGGCTCAACAATAGCACCCTCCTCCACCACTTCTTCCTCTTTCTCCTCCGCTTCATCCAAGGAGTCGAAGAGACTCTGATAGAAGCGTCG
AGTCTCCTTCTCCTCGCGGAGTGGAGACTTAGAGGCGGTACGCTTCTTTGAGGGCTTGGCGTCTTCGGCTTTAGAGGCCTTAGCGCGCGCAAGACCCTCG
GCAAGCGAGAGACGTTTGCGAGGGTTCTCTTCCTCATCGCCACCGGCTTTGGGAGCGCCCTTAGCCTTAGCGGCCGGACTCTCAGAGCGCACAGAGGGCC
TGGGACTGTGATCACCGTGATCACTAGCGGGCGCCTGCACGCTGTCATCTTTGTGCTCACTGGGCACTGGGCTGTTCCCTCCCACAAAGCCCGCAGGAGC
ATCATGAGTGCTCTCGGACTCGGCATCGTCTTCACTGCCCGAGTTGAGCTCACGTTCTACGAACCGAGGGCTCGGACGATTGTCTGAAGACGAGGGCGAC
GGACTGCGGCGCTTGTTTGCGCGCTTGTCCACAGCCGCGTCACTTGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTCCTTGAGTGCCGAGCCTT
TGCCGTGAGGCTTAGTGCTCTTGGCTTGCGCCTTCCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGCTCTTTGCAGTGCCACGAGGCATGATAACGGT
CGAAGTGGAGACCTAGACGAAGAGCACACAGGTTGCTGCTCGAGGCTCTAACTGTGAAGTGAGCCTCCGCCGCGTTCGCGCGGCCAAGTCGATGGTTTTC
GACTTTGAGAATGAGAGTTTGTGACGACCACCTCTTCATTCTGATTGGTCGGTAAACCGAACCTAAGTGGGGGAGGATGTAACGGGGTACGTAGCCCTAA
GTGTACCCTGGTTACATGAAGTGTGACACTTCACACTTCAGGAGTATGACACGTCATACTCCGGGATATTTGGTACAAGGTACCAAGGTCGTTCATAGCC
AACCATTGGTTAAATGACATTGCATTTCTATAGGTAACTTATAGTTTGTATTAAACCCAAACTTAATCTACCTATAAATATACTCAGTTTACAATCTACC
TTATTTAGGTCACTTCGCTCTCTTTAATTAAAATAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTTGTATACTCTCGGAAGATAACTTCCTCTAGCGC
AAGGTGCTATGTGACCCCGTCACAT