Description :
From Genome Similarity Track
Location :
Scaffold_2:1257166- 1261724
Sequence
4558 bases(100 bases per row)
CCCTGCAGAGCCTGGTGGCGTCAACACTGGCCGAGCAGCTCGAGCGTGTCAATGCGTTTGACGCTTACGAGCAAGGGCTCATCGCACATGTGCGACACAC
CTGAAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACTCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAAGGTGAGAACCTTCACTTCT
AGGTCCGAGGAGTAGAGCCCGCGATGGACGCGGCTCTGGTCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTTCTAAGCG
TTGGGTGTACACGAGGGAGGCGACATCGCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAG
TACCGGCAGCGTTCGCGCTTCCTCTCATGCAAGGAAGGAAGCGCGAGTACGTCCAAGAGATACGGGAACTCACGGCGTCCCTAGTGGGCAGCCCACTCAG
CGAACACATCAAGGTAACTGTGCTCATGGACGGCCTTCGAGTGGGCCCGGCGCGCACTCAGCTGTTCCGGGTGCAGTGAAGCACTTTCAAAGCTGCTGAT
TCAAGTGGCTCTTCAGAAAGAATACAGCCATCGCCAGGCGCGCACGCCGGCCTCAGTATGACCAAGGAATTCTGTGTCGAATCCCGGTCGAGCAAACCCC
GACGGACAAGTTCTTCATGGACAGCGGGTCCGCCGAGCAGCGCGATATTCGCTGGTTAGACTGCAAAAAGCTAGGCCACTTCAAACATGACTGTCCCGCG
GAGAGACACCACAGCCAGACTTTTTTCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATTCCGGGGACAGGGAAACGCCGGAGTCCAGTAGGGGC
GGGGCGCCCTACTGGGGAAGAACTAAGGCTTCGTGAGGGGTGCGCGGGTGACGCGTACCACTGGGACTTAGCTCCTGAGCGTCGTCGAACTCTCGAATCG
GCGAAGAGCAGCGGCGGGCTGATCGTAGTACACGGATGTGTACGGGGATACGATCGCCCCTTTAGAATCTTAAACGATTCTGGAGCGTCGAAGAATTTCG
CACGCCGCCAGACGGTTGCTCGTAAAAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAAGGCAACAAGACGGTGTCAGTGCGACTAGCCGACGGGAA
GGTCGTCACTGCTCCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTCAACAGCTTAGAACAGTTTAACATTCTCGACAGGGATCACTATGAT
ATGAGCTTGGGCATGCCCTGGCCTTAAGAAGAACGAGCCCTGGATCGACCGGCGAGGCAAAGAATTCGGTGCCAGTCGCCCTGCGAAGACCGACAGAACA
TTGGTGAGTCATGTTCCCGCCTCTGTCAGGACCCGGGGCGTCCGCAAGGGCTGCCAGGGTACCGAAGCATCCAGCAGATACTTGGGAGTCGCCGACGTAT
ATGACGACTTGGAGGACGCTTCGATAATGGCGGCGCGAGGAGGCGCTGGCCAAGTGGGTAACTTAAGTCCACACGCGGCTAACATAGTTCCGCAGACAGC
TGCAGCTGTCACGAACGCTGGTAATAGCGTGTTCAAGGTGGGTAACAGAGCTCCACACACGGTCGCCCAGACCTTAACGGAAGAGGAAGACGTCGGATAC
GCTTCCTGGGTGGGTAACACAGTGCCACACTAGGCTTCGAGTGCCTCGGATGTCGGCACCACGTCATCCCCAGACGTAGGTAGCGACGTTCCACGTCACG
GTCGCCGTCGACGACGACGCCGCAGCCACCGAAAGTTGGATTTGAACCTCGTTCAGATCGACGTTGCTTCAAGCGACTCGGTTTCCAGGGCCCGGACTCC
TCCAAAACGGCCGGTGGAAGAATGATATCACATCTTCGATGGCGAGACCGGATTACCCGTCAAGACATCTGGTGTCCACTTGGAACCGTTGCCTGAGGTT
GCAGAGATACTGAACCTCGAGGAAATGACGGCCGAGTCTTTGCTGGCCAGCCTCAAGGCTGAGGAGGTTGCCGAGATGGTCTAATAAGACCTGAGGCCAC
TCGGGGGGAGCTGAACTCCTCCTCTGTCTTGGATGAGGGTCCTAGAAGAGCTGAGCAAGCAGTGTCAGACGCGCTTGGGCTCTGAGATCTTTAATAATCA
AGGATTCGGTGTATCTTTTGGCGACGGAGTATGCGGACGTGGTGAACGTTCATCTACCGTTCCAACTCCCACCGAATCGAGGTGTACGGCATTAGATCGA
TCTCGTGCCTGGCACAAGTACTGCGTCACGAGACAATGGCCTCTTCCACGCGGACAGTGCGAGGTCATTGATGCCTTCTTCGCTGCGAAAGCGAAGGCAG
GCATGGTGCGGGAGTCAAAGTCTCCGTACTTGACGCCAACTTTCTGCGCTCGGAAGCCGAACGGGGAGTGGCGTCTAGTTCACGCTTATAACAAGCTGAA
CAGCGCGTTAATGTCGGCCCAGACACCAATCCCACCAAAGGAGGTGTTGTTGAACAACATGGCCGGAAGCTTACTGTACAGTGCGCTGGATTTGGTAGAC
GGATAATACCAGATCCTGATACGCGAGAGCGACAGCCCGCTCACCGAGGTGAGCACTCCAAGCGGCATGCTTTGAAAGTGGCTCGTCATGCCACAGGGCT
TCTCTAACGCCCCGACGACATTCAACCGGCTGGTGACGCAACTGTTCAGGCCATTGCGCGCTTTCGTTCAAACGTACTTCGACGACATCTTCGTCCATAG
CCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATTTGGGGCACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGAT
AAGTGCATTTTCGCGTCACCAGAGATTAAAGTTCTGGGTTTGCTACGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATTGCAGCA
TGGCCGACGCCCCGATCCCAGAAGGACCTTCGAAAGTGGTTGGACTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGTCTTCACTAAGCCCT
TGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCATGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGACCCCAGTCCT
GGCCCTGCTGGATGAGACGAAGCCGTTTACCATCGTCTGCGATGCCTCCAATTACGCCATCGGATGTGAATTACTGCAGGCCGACACGGCTGGACATGAA
CGAGCTATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCACGACAAGAAGCTCCTGGCAATGAAATATGCCCTTGTGAAGT
TTTGGGCGCATCTTCTGGGCTCACGGCCCTTTGTGGTCTATACATACCACGCATCCTTGAGGACGGCGACATATTCGCCTCACCTCTCCCAACGTATGGC
GAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGTTGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGGCGCCCTCTCTCGGCGTCCATACTAC
GAGTTGGATCACATCACACGGGTGACAATGGATCTACATGATCGGATACGCGTGGCGTATCTGATCGGGACGGTGAGGCTGTTGCGCCTATCGTCCGGTT
CCTCGCAGCAGGAACGAACGCGAAGTCCGACTGGATTTCGTCGCGACAGCGTTCCCGGCTCCACCGATATGAGTTGAAGGATGGGCTCCTCTATAACTGA
GAGGAGCCTACTGAACCCCCACGGGTGGTCGTACCCAACGCGGAGGATCTGAAGCTCGACATCCTCGCGGAGGCGCATGATGCGCCCTCCAGCGGTCACT
TGGGTCGAGAGAAGACCTTCCTGTCGGTCTCGCGGGCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGATAAGTGAAGACATGCGAAACATGTCA
GCAGGTTAAACCCGCAGGGTACGCTTCGGCTCCGCTACAGAGTCTGCCCGTTCCAGCTGACAGCTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTT
CCCGCCGACGGAAACAGCAACACCGGAATTTTGGTGTTCGTGTATCGGCTGAGCAAGATGGTACATCTTGCACCAGTACCTGTTACCGTCACAGGCGAAC
AGACCGCGAGGTTGTTCGTCGATGGCGCGTTCCGCTATCATGGTCTCCCGGCGACGATTGTCTCGGACCGAGACCCGCGGTTTACGGCCGCGTTCTTGGA
AAACGCTGTTTTCTTTACTAAGACCTCGTCTGCAGATGTCCACTGCGGACAATCCGCAGACAGACGGTCAGACAGAGCGCGTCAATTGGCGCTCGAGGAC
ACTCTGCGCAGTGTGTGCGCGGACGAACCACGTATGTGGTCGACGCAGCTTCCACTTTTTGAGTTTGCGCTCAACAACGTGGTAAGCGCGTCCACGGGGC
TCACGCCGTTCTACTTGAACGGATTCCGTCACCACAGAGTACCTTTCACTCTTTGAGG