Description :
From Genome Similarity Track
Location :
Scaffold_3:125704- 133582
Transcript NameFunction/comments
Hyaar_Emoy2800542rod shape-determining protein MreC
Hyaar_Emoy2800543hypothetical protein
Hyaar_Emoy2800544peptidase M48 Ste24p

Sequence
7878 bases(100 bases per row)
TGCATAGCTTCGAGCGATTATGGCTCGTCTGCTTGCGTTTAAACTCTTGAAGTAAGGATATACAATTCAAATCAAGTTCATCCATCCAAAAGGGGTCTTC
GTTTCCCTTCCAACGAACGAGAAAATTTGGTTGCTGTCGCCCATAACGTGTTTTCTTAACCATTGCGGCTCTTCAAAATCTCGTCGACCTCGTATTCACC
CTCTTCCAATTCTCGTACTCAACGGTATTCCAGCAGTAGGCATTCTTCAAAATCAACACAATCTGCTTGGTCAACTGCTAACTCGTTGTCTGGTCGATCA
GGGAATTTTATGACCCACTTGAGCTTGGGTATGTGTACAATCGGAAACAGCCGGTATTCCTTTCCCCGGATTTTCAAACGTGCGGCATGGTCTCCCACCA
GCTCCAGAACATGCCAAAGATGAGCCAGTTTCCAGGCGTATCCTGCTTTTACTCGGTCGAGATAGAGCCATAATTGGGTTCCCGGTAGAATCTTTGGTCG
TCCACCCCTTCGTTCTGCAGTTGCACTCGCATCTGACTCGCCTCTCGCAAGTTCTCGTTCACCTGTTCTCTTGCTCGCTGGTACTGACTCTGAATTCAGT
ACCTCTACCTTCTGGGTTCCGAATCCTGACGTCGGACGTTCACTATCGGTAGGGTGGCTTCATGGGTGGATCTGGCATCCCAACCGTGGACCAAATAAAA
TGGCGTTTCTTCTCGTACCCGGTCACGTACGGTATTGATCGCAAACTTCAACCGCTCTGCGTACTCGTCCCGGTCCTGTTGCCCTACATCCGCAACGTAC
AACTTGATAGATCTGGTTAGAGTCTGGACAATTCTCTCCACCGTACCAGTAGCTTGGTGTCGGTGGGCCATTGTCGCTTGTTGACGTTGACCCACCATAC
GGTTAAACGCTCGGAAGAAATCTGACATAAATCCCGGTTCTATATCGTGACGGATCGCTTCGCTAGCCCCAAAACGACGGATACACACTCCTCGTATCCT
TCAGCAACCGTCTGAGCTGTCCGCGACGCGCTAGCCTTGGCCATTAAATATCCGGTGATTAAGTCAACCCATATTACAAGTTCTGTATTTCCCTTTTACG
ACTTAGACAGAGACGGGAAATTGTCGATCGCTATAACTTGCAAAGGATAAGTTGCTTCGATGTTCCCACAGATCTTCCCTTGTAGGGTAGTTCCCCCTTT
TCCAGTCTCACAATCTATGCAAGAACCAAAATATCTCCGCACACTCCGAAACAGACCTTTCCAGTGACAGTAACGTCGTATGCGTTAGTATGTACGCCCG
ATTCCTTGATGACCTTCTTCTAAACTCGTATAGTAGTGGTGAAGGAAGTCAGTTAGGAGACTTTCCGGTACCACCAGTATGACCGTTATGTCACGGTCTT
CTCCCTCGACTCTAGAATTTGGACCATATACTATTAATCCTTCCTCGCTTACATCGTAATCTCCGTACATTTTACGTTTTAGCGGATTCCACCGACAGGT
CACTCCAGTCTCCTTTCAAATATGCCTTTAAATCTCGTACCCAGTTCTCCTCTTCTTGCGCGTTTCAAATTCGGTCCACGTGGAGTCGCAGTACTACCTC
CTCTTGCATGGGCTCTTCGGATATCCTAATAGGAAACTGTGACCGAGTAATCGCAAATATCATGGTAGAGAAGTTCTGGTCTTTAGGAACTAGCAGATCC
GGTAGACGATTGATCGCTTCCAAGTCTGGCCTTTCTTCACTCGGAACCGACTTGATCCCTCTTTTTGGTGCAAGGCTGTACTAGCTAACTGATCTGCGCC
CTGGTTCTAATCTCGTTATCCATGCAGGATCCCGTGAGAAGGCCACGACTGGAGTTCGTTTAAAGTCTGGGCTCATAGCGCCGATAGAACCGAGGCCTTA
CACTCAATTCCCCCTCGCATCTGCCGCACCACTAAGTTGGAGTCTCCGCAGATAATCAACCGTCATCGTTCCAAAGGTTTCAAATAGTCAAATCCCAGCA
ACATACCCGCATACGCTGCCTCATTTACCGTAGATGTATCGAGATATTTAGAGGTGGCTTCGAATATTGTCTAATTCGGGAGTCTCCATACGATAGCACT
ACAAGCCCCACCTCCTTGCTTGAAACGGGCTGACCCATCGAAACTCAATACATATAGTTCTTCGTCTAGTTCCACAGTGGGGGTTCGTAGGTCGATCGTC
TGCCTCGCCTGCTTCCTAGGCGCAATGGCCGACAGAGTTGAGTCTACACTCTCTCGAGGGGTAATACTGGCTGCCAACGCCCCCAGCACCTGGTCATCAC
CTTTTTAACACTTCACGATCTCCAAAGTACACTTAGACAAGAGAGCGGCCCAGTTCCCTAAGCAAGCAGGCAGATTTTACTATCCATGCCAATGTCGATT
ATCTTGTAAAGACTTTGAGGGGCCGAGTGACCCGCATGGTGAAGCAGGTCTCCAGTATACGCAATAAGTCTATCACTACTTTCTCCTCAATAATGTCATT
TAGTTCGTTAGCCTTGAGGGTTCTGCTTGTAAAAGTTACCGGCATAAGCAGTCCTTCATAATCCTGTACCAGTGACGCTGAAATGGCCCATTCCCTCGGA
TAGACCATAATCACGGCTTCTTTAGTTGGGTTTAAGTGTCTCAGAATTGGCTCGGTGGCAATTTTATTCTTGAGCATGGCGAACGATACTTGACACGGGG
CCACCTTTTTCATTTTCATCCTGCGAAGTGGCACTATTATCCCCCTTCAACTGGTTTTGTCGGGCATGAAAGTCCATCTCTCTCAATTCGTAGAGAATAG
ATGCATACACGGCGTAGCCCTCAATAAACCTACTATAGTAATTCAAGCTTCCCAAGAAAAAGATTGCATGTCCGTCAGTGTCATTGGTAGGAGTAGGTCG
ACCAGAGATTGGAGGTCTTTCGGGTGAGTCTCTATTCTACCCTGGATACTCGATGTCCAAGGTAGTCGACCTTCCGATATCCCCACGAACTCTTGACTGC
GCTGATTGATAAATTCTAGTAGTCGCACACATCCAACAACCGTTTAACCTTTGTTAATAACGCATCCCACGAGTCTGCAGGGATCAGAATATCATCTATA
TATGACCGCTGACTCAGGATCAAGGGAATCAACTACTCATCTGGCTCTCCCACCCTGAACAAATCATCGGACCCATCTGTCTCCGCTTCTGGAGGGATTC
GTAAAAACCCGAATAAAGCGTTATCCAGGAGTCTTTGATATATTTGGGGCGCGTTCTTGAACCCAAACGGCATTCGCATCCATTCAAACAAACCCCGTGG
GGTAATGAACGCCGATAATCGTCTCGCCATTTCAGTCATACCGACTACCCAAAAACTACTCGCCATATCCAGTGAGCAATACCATAATGCCTTGTCCAAA
TCTTCCAGTCATTCATTAATCAGAGGCATGGGGTAGACCATTAGTTGAGTCAGGTCGTTCACTAACCTGTAGGCAATGCATAGCCTGATGTCCACCCCAT
TTTTTCTTCACAATAATAACGATTGGGCTGGCCCAGGGTGACGTCGAAAGCTGTATAATTTTTGCCGATAACAGCCCCTTGATCAGATCGGTCAACTTCT
CCTTAAATTGGGGAGCCACTTTGCGTACGAGTTGCGCGATCGGCTTTGCGTTTTCTATATCAGTGCCACATATAGCCCCTCGAACTGCTGTCGGTTAGGC
AATTCCTTTCTCCACCAACAGATGTCTTCTCTTCCAAATGATTTGTCGCAGCCGGTCCACCTCTTCTAAAGTGTTCCCATCCGGATCAGGGATCTGTATA
TCTTTTAATCCAATAGATTCGGAGGAGGGGTCCACTTCTGGTATGATTGCCCACACTCGGATGATGTCTTCGGCCCACAGGTCTCCACTTTCGAATGTAC
ACACATTTTCATCGTTCCGTGGCGATTCGTTGACCTCGGCTCCCTCTTCATCGACTGCGATCGCTCCCGGTGGATTGTCTTTGGGACTACTTCGTCCTTG
AGGGGTTTCTTCTTGTAGAGGCACCTTTACTCCGCATGACTGTTCTTTTCTCTCTGGGCGCGGCTGGTGTGACACATTCATCATTGAGACTGGGGTCTTC
GAACGCTGTAACATACGAGACGGGATCTTGTACCGCGGGGTCTCCGCCAGTGGTGTCTCGTCCCCCTCCTCGAGGTCAACTTGCGGGTAGACCTGGTCGG
TGGTGGCTTCGTACGCCAGGTTCAGCCACTCAGCATACCTTCGAGAGCCTATCGAGACGAAACCTTGTGTTCTTCGTACTTTATCCTTCGTCAGCCACAG
ACCTCTCTCGGTATCATCATGTAATATCAACGTGTGGAGGATAACGTTGGTCACCTTCAGCAATTGCTGGCATCCTATCCTCCGGGTCGTAGTTGTAACC
CACCTGTCTCCTCTTGTGAGCCATATCTTCCATCGATCTGAGATCGACTTTTAAGAGGTATCTCCACGCATCCACCAGCAAGTATACGGGCATATAGTCC
TAACTTCACGTCTGAGACTCGGTTATCGTAAACGGACCTCTGTCCGGAGAGTTGTATCCGGACTTCGTTAGGGAGACAGAGTGTTTCATCCGCCAGATCT
AGCCGGATCACAGCCGGAACTATGAAATCCATTCCTAAGATTGCATCCTGACCCACCATAAGGCCTACCCACACCTTGAACACATAAACTAAATTTCCAT
TTAGGGTGACTTTGGTGCGAGTGCGCCCTTCCGTAGAGTATATCGATTCTCCAATGCCAATGCACTCCCGTCGTTCGCTTTCTTCAATTCGGCAGCCTAC
CTTACGAGCAAAGACGACATCCAAAATGGATATCTCGGCGCCAGTATTGAACGACAAATTTGCGCGATTATTGTTCATCTCCCCAGGCTTTGGCTTGTTT
AAACCACTTAGATGGGGCATGGTATTTCCAGTATCCTCGGGATTCTCCAGGCAATAGGTCTAACTCCATCACTGCATTTTCCCCGGCAAAATCATTGGGT
TCATTGAGAGAGGCAACATGGACCATGGGATATTTTTCTATCTTCGATATACTATCGGTCTTCTCAATGGAATACCCTCTCTCCTCTTCGGGCTGCTTTC
CACATATGCAAAGATATAAAACTAGAACGATCAAATCGTACCAGATTCAAACCTGGCGAGATTGATAATTTAACACCTTATCTGCTTTATCGGGCAACAT
TCCGGCGTGCTTGGTGGGGTTGTAACATTGACGAATCAAGTTGTAGAAATCCTCCAGCTGGCACCCCCCCCCGCTTCATGGGTCTCTCCGCACCCACGGC
ACACAAACAAGCGGCAATCCGATGGATGTCCTTTCTTTCCAAAGTGGTCCTAGGTCATTCATTCTCTTCCAGCATCTCAAGTCTCCATGTCTCCTGAACC
CGCAGTGGGTATATCTCACGTTTGACTCGGCCGACGTATTGTGGGTTCCCGGGTCTTCTGCTTGTTTCCGATACTGGTTGACCTCTCTAGAAGGGGCCGA
AACCTCGTGGTTCTTGGACTTGGGTCCCTTTCCGCTTCCGCTAGGTAAATCTGTCTCAGGTCCTCCTCGTTTCCGAATTATCCAGGCTGGATCCCTCTGA
ACTCGGGTCTTCTAGGTCGCTCGGACTGCATGCACAGAACGGCGGTTTACATCTCTAGGTAGATCCGGAGGCGCTGATACCTTCTGCCGGAAATTGCTGG
AACCAACCAGCGGCTTGCCACGCCGTGCCTTCGTCTTCTGGCGCGCCTTCAATACTTACTTTAGTTCTTCCACGTCTGCTAGGCGTAGCATCGTCAATTG
GTCTGCCAGCTCTGGGTCGTCTACGGTCGCGATGCAATGCTCGACGTGTTCATTCTGGATCTTGGGTGATCCACTCTTAATCTTCAGCTTCGCCCTGAGA
GCGATCACTTTCAGGCGGTATAGGTAGTCCAACGGGGATTCGTCTGACATTTTCTTCGCGTGTTAGTATTGGCGGGCAACTGGTACCCCCAAAACACAAA
TCTGCATATGGAATTCTTATAGAGGTACTTTCACGGAGCGGCCAAATTGGCGGTACCAGTTCTGCGCCGTCCCGATCAGCAGTTCTCAGAAGACAAGACA
CTTTTCGCTGTCCGGTGCTTGGTCCCTTGCGAATGCCGTGCTCACTGTGGTTACCCAACTGCGATCTCGGTCCTCGTCCAGGCCTCGACCATTAAATGCT
TTGAGGTCCGAAGTTGCAGAGAGCCTGATGCGAGGGACCATGTTGAGTCCCTGTCCCATCGTGGCATAGGCCATCCTCGCCAGGGTTTCTTCCAGATCCA
GGTCATCTGGGTCGCATTGGCACAAGCTGACCGATTCCATGTTGACGTCCGACGTTGTGGGTTGTCTTTGGGATTGGAACTCTCCACTCGAACCGTTTCC
AGTAGTCGCCGGTCGTGATCCCTGCCTTTTTCTGGTCTCTTCTCGGTCTGGGCGTGTTGATGGCGCTTGGCGTTCTTGGAGGAACCTTGCCATTGCCGCG
TCGAAGTATGCCTGGAGATTACCTACCGGGAAGGTAGGTGCTTCCCCCAGAATCTTCGCCAAGTGGCGATGTTAAGGTTTCGGGATGATTTGGTTGGATC
GCTATTGGGCGAAATTGTAGCCTATCAGGAGTCCGCATTTCCGTTGGCTGTCCACGCGTCGCCCCGTCGTGAGCAGGCTGTTCCGCCGGCGCATCGCGCG
CGCGGGTCTGAAGTAACGCGGCACCGGTAGATCCCAGTGGCATTCGGGCGACGTGGCTAGGCGCTGATGATCGCTGTGACGAGTACCCTGATAGGCCTGG
GCACGTGAAGACTGGGTTTCACGAAATGGCAGTCCCATCGACCGTAGGTCCCAGGTCAGTGCTTGTGTTGGGGAGTGAGCCTCGATGTCATGAAGAGTCA
TCTGACTGTTTCTCTTTGGTTCATACACGTTTGTGATGGAAGACAAGGTGTGTCACGCAGGATTTATCCCGAAAAGAATCCCCACACTCCTGTGTAGTTT
TCCTAACGTTGTTGTGATGCTGTCGAACCCCAGGGCACCACACGTCGCTCGGAAATAACCTCTCCGCGACCATGCCTGCTTCTCGAAGGAGGGTCACTAA
CGCGGTGATTGCATCTGTGATCGTCCGTTTCGTTCAAAGGGGCGAAAGTGGTTCGCAAAGATGTCCAAGCAGTTGGGCTCGAGGGATGTCGCCACCGGGT
CGCTGGTCAAGAACGTGTCGATCTTACGTCGGTGGTAGGCCATCGTTATATCAGCGTCCTACCAGGTTAGCGGCCCTGAGCGTTCGGGGTCGGCCGACAT
GGTGTCGGGGCGTGATGGACCAGGATCTAACGACTTGGTATCGCCTGGCCCCTTCATCTTGAACTGTTTTTGCCTGGACGTCGCAATTTTGTTTTGTTTG
TTGTTGTTGTTTAGGGGACTTTAGCATATCGGCTTTCGCCTTTTGCTGTTTTCCTCTGGGGCATGATATGCATCATGGCCCAAAGTGACCTCTGTGAGGA
CAAAATGGATGGTATTTAGGTTTCTATTCAATAAGTTCAACGTTGACCTTGTTGACCTGGCCCGTCCCAAGAACCGGTAGGTCCTTCGATCTTTTGTTTC
TTTCTTCTTTAGTCACTGGCAATCTGTCATCCAGTAACGCTTCGGTCTTTTCCTCAATCTTGACTTCAGCATCTTCTTCCCCTTACGACTCGCAGTAAAA
TCCCTGGGTCGAATCCGGGCACGCGCATCATTGTGGTGAAGTGGGTTACCAAAAGTGCGTGTTGAGCCCCCAGAACACTTACTGCGCCGGACTGCCGACT
TATGGGGGGGGGTACCCGATTCCACGTATGGAACTTGACTCACCTTGTGTACCCGTCGGCTGGCGGGTTGCACTCTTC