Description :
From Genome Similarity Track
Location :
Scaffold_2524:1257- 3060
Transcript NameFunction/comments
Phyta_totarag14583hypothetical protein

Sequence
1803 bases(100 bases per row)
ATgattccctacaccacaGGAGTCCCTTGATCAGCTGGAATAGCTTCTCGCGGAACTGCGGAGCGACCTTTCGGATCCGTTGGGCTACCGGTTTCGCATT
TCCCACGTCGATGTCGCAGATGACTCCTTTCGCGGCCGGCGGAAAGGCATTGTCTTTCCCAATTAGGAGGTGCCGGCGTCGCCAAATGATCTTCACAAgg
cgctcgatctcttcgGGCGTACTCTTCGCAGGGTTCCCCACTTGAATTTCTTCGAACTTGATTTCTTCAGTCGTCGATGTGACTTCCGGCAATACTGTCA
TGTGCCCTTCAAGATCTTCTGCAAACAGCTCACCTCCTTCCATGATACACACTTGTTCATCTTCTACGTGGGCTTCCGCGTGAACTTTGGTGAGATTAGT
TTATTCTCCTCCAGATCCCGTCTCAGCATCTCTAGATTTCTGCCAGTCTCTGTAGGTCAATCTAGGATGCGTTTCTGATTTGTATCCATCTCTGCACCTC
GGTCTCTGCAATCACCTGAATGTTGACTTCTGCAATCAGTTGCATACTGACATTTACCATCACTTGCATACTGACGTCCCCAATCATCTGCATACTTTGC
CCTTTCTGCACCCGCGACTGGATACTTGGTACACTCATCGATGCTGACCTGTTCTTTCCCAGCCGGCGACCGTGCGGAGTCTTGTCGCGTTTCTTCCGTC
GTTGGAACGCCCTCTCGTAGGGTTCTTCGGTCGTGTTCTCCGCCATCTTGgttgtcgccgctgccgagCATCGCCACTTTTGCCGGTTGCTCTGGCAGTC
GGGGCAAGATCGCCATTGGCGTCCTGTAGAGCGGTCGGTCCATGGCTGGCTCCTGCGGCTCCACGACCTCCGGGAGGTTTTCGTCGGTGTCAGCGTCGAC
AGTCGCCTGGTAGGCCAGGTTTGCCACTCGGCGTACCTGCGCGACCCCACCGAGACATATCCAGGTAAGCGTGGCACTCGATCTCCGGCCAGCCATATTC
CAACGTGCATGTTGCAATCCAGTACTAACTTGTGATCGCTCGCGTTTGTCAAGTGCAGGTAGCGTGTCTTGCCAGTGCCAACTGTCAGGGTAGGCACCCA
GCGATCCCCGCAGGTCACCCACAACTTTCGACTCTCAGGATGGCTCATGCATAGTTTCACTTCCGCCGAcccaccaacttcaacgtatCGATCTTCGCTC
AAGATCACTTGTTCCCCGCATTCTCCGTAGAGCGGGCGTCTGCCGGCTAGCTGGACACAGACTTCGTCGGGGAGGCAGATCGTGCCGTCggcaagatcga
ggcggatACCAACAGGGaccatgaagtccatgccGAGGATCACCCGTCGGTGGACCTACCCAGACACTGAAGAAGTAGATCAACGATCCAGCGAACGTGA
TCTTGAGTCTGGTACGTCCGTCCACCATGTACGGGGATTTCCCAACACCTTTACATTCCAGTGTCTGACTTTCGTCAATGTAGCACCCAACCTTACGAGC
AAAGGCGGTGTCAATAACAGATACCTCAGCACCACTGTCAAACAACATGGTTGCTTTTTCGTTGTTAATCTTTCTCATAGGTTTCGCCTGCTTGAACTCC
TTGTCGGGCACATGGTACTTCCAGTAGCCACGCGATCCTCCTGGCGAGATGTCAAAGTCCATCATCACTCTGGATCCTGAGTACTCATCTTGTGCACACT
TGACACAGCAGTGGTAGCTTTTCAATGAAGATCACATGTGTTGTCGACCGGATTCATCAGCTTGCTAACCATCGACTCCGATTGTTTCTCGACGTAtgtg
tgg