Description :
From Genome Similarity Track
Location :
Scaffold_318:12567- 14391
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_318-fgenesh-gene-0.0THO complex 2

Sequence
1824 bases(100 bases per row)
AGCTTTTATCGCAAGTACCCGAATGTGGAGCTGGAGGGACTGCTGCAGTACCTGATTAAACGGCTTGAGAACTGGGCATCCGTGGACCTCATTGTGCTGA
GCGAGCTGCTGTCGAAGATGGGTTCGTGCATTAGTCTCGAGGATATTTCAGTGAACCAGCTCGAGGCGCAAGCGGGCGGTCCACACTTGTGGCACGAACC
TCCGACAGACCCGAAGCTACAGAACCGGCGGGCGATCCCTCTTTTGCGGGACGCTTTAATCAAGCGCAATCTCGCACTGCCGCTGTGCATTTTGATCTGT
CAAATGCGCAGCAAGATCGAATACCAGGAGGACAAGGCGCTGCCGCACTTGAAGCTGCTGGGGCGTGTGTACGACACTTGCCAGATGACGTTGACCCAGC
TGCTGCAGTTTATGAATGGTGTCGTGGATCCCGTTGTGTACAAGGATATGCTGCCTCGTCTCAACGCGCTCGTGCACGATTACCATGTGCCGGCTGAGCT
TGCAATGACGCTGTGCCGACCCGCGATCCGATGCGACGACCCCGTGCTGCGCCGTGCACCGCGAGGTATCAACGCTCCGGCAAGCAAGAAAGCTGAACAA
TCAAGCACAGAGGATGCGGCGTGGTATATGTACAGCTCGAAGCTGCTGGACGATGTTGGGACGGCACTTCGAAGCGACAACCGCGACCCATTCGTGGGGA
TGACGCGCGAGATGTATGTGACGTTCTGGAGCTTGACGCTGTACGACATCCATATCCCGTTCCCGCAGTACGAGGCCGAGATTCTTCGCCTGCGTAACTC
GATCAGCGGTGCAGCTGCAAACAACGCCAATCTCTCGAGCAGCGAGCGGAAGAAACTGAAGGAGAAGACGATGCAGCAGATCGACAAGCTGACGAACGAG
CAGAAGGATCAGGTGACGCACCGCAAGCGCGTGTTTGAGCGCCTCGAGGATGCCAAGAGCAAGTTCTTTGTCAAAGAGGCTGCGGCACGTCAGACAGCCA
TCAACGAGTTATTGCAGACGTGTGTGGTGCCTCGCGCGCTGCTGTCGCCCGAAGACGCTTTGTTTGCTGCCAAGTTCATGGAGCGACTTCATGTGATGCG
TACGCCGGTGTTCAGCCTGCTCCAGTATATGCACAAGGTCAACATGAAGCTGCCGCCGATCGTGCTGTGCTCGACGGAGCGAGAAGCGGGGAACTTTGGG
ATCTTTCTCAAGGAGACGCTGCTCCTCGTCCATCGGTGGTACCAGAGCAGCGGGACGTACGACGAGGAGGCGGCGCACGGGTTCAGTACGGACCTAGCGG
ACCCAGAGAACCCAGCGAAGTGCCTGTCATTCAAGCAGTACAAGACTACGTATGTGCGTTGGCATCGCGCGGCCGAGAAGGTGTACGGCACGACGTTGAG
CAGTGGAGAGTACATGCAGATCCGCAACTCGCTGGTTGTGCTCACCAAGATCATCGACGTGTTCCCGTCGGGTAAAGGTGCGGCCGAGGTTCTGCTCGAC
ATTGTACGTCCGCTCACTGAGGAGGACCGCGAGGACATCAAGATCATGGCGAAGCGATATTTCGCCCTGCTGACCAAGCGCAAGGGAGCTCTCGTCGACG
ACAAGAGTCTGTCGGCGCGTGCGTCCCGTGCATTCCTGAAGACTGTGACGGATCGGGTTGCGCCAAACGAGCGTGACGATGCTGCGAAGCGGAAGGACGC
AGGTACGGACGAAGAGGCCCTCGGTGAAGATCGCACTGAGCCTGTCAAGGCTCGCGCCGGTCGAACCGACGATGGGTCGCCATCGCGCGGGGACGAGCTC
GAGAGCGGCGAGATCGCTAGTTAC