Description :
From Genome Similarity Track
Location :
scaffold_708:12567- 14253
Transcript NameFunction/comments
g9962.t1 hypothetical protein PHYSODRAFT_354994
g9963.t1 ubiquitin carboxyl-terminal hydrolase, putative

Sequence
1686 bases(100 bases per row)
CTTTTGCCACAAAGCGAATAAGAAGTGAACGAGCAGCTATGCAGATCCAGATCAAGGTGCGTGCCAAGCCCCGAACAGCCTGAGCGCGAGACACTAAGCG
TTATGTTGCTGTAGACACTCACGGGCCGGAAACAGACCTTCAACTTTGAGCCGGACAACACGGTACGCAGTGCGAAATCCTAAAGTTGCTGGAACGGGTT
GACACTGATGCTTGTTGTTCGTCTTTGGGAGCAGATTCTGCACGTGAAGCAGGCGCTACAGGAGAAGGAAGGCATCCAAGTGGACCAGATTCGCCTCATC
TACAGTGGCAAGCAGCTGTGCGTTCTTGTTCATATTATTTCAAGGGAATTCTGTACTGACATGCTTTCTCTATTGCTGCTGCAGAGCGGATGACAAGACG
CTGCAGGACTACAATGTCGCCGCAGGAGGAACTATCCATATGGTGCTGCAGCTGCGTGGAGGGTGCTAGTGCGATGGAGTCCCGACGGGGTTTTAAACGA
GGCTGTCACCTCCAGAAGACCGAGATAGTTAGAGTAACACGTCAACACCTTCAGCACACCTCCAACACTATAAGCAGCCCCACAAGCTGCTAAACGCGCC
AAACTCCCACGCACATGGAACGAATGATTTTTTTTCACTTACTGTATCGTCTTTTTCGCTATTCTTTCAGAAAAAAAAATCTTTCTACTGCGCGTTCGTG
GGCTTCGCTGCGTTTGCGGCAATGCGCTCGTCGAGCTGCTGCTTGATCAGCGGCTCCAGCTGTTTCTTCTCAGCGAGCGTCTTCAGAAGCTGGATGATGA
AGGGAATGTAGTTGTGCTTACGGCGCTTGTTTTCCAGCGCCCAGTTCTCACGCTTCTGCTGTTCAGCAGCCAGGTCAGCTTGGATCTGGGCTGCCTCGCT
TTCACTTCCGCCCGTTTCAATGACCGCTTGGAGCTGCTCTTCGTACGTCTGTATCCGGTTCTTCACCAGTGCCAGCAGATTGAAGCGGATCTCCGTAGCC
GAGTACTTCTCGATCCTTTTCTGAATAACAGGACAGGCCACCTGCAGCCACGAGTCTCGGTTCTCCGGTTCTGAGACCTCACCCAAGCAGATAGGACCTT
CCCTCAGTCCATCAAGTTCGTAGACTTTGCCGTTCACAGGAACGTAAGCCACAAAGTGATAGACGTCGTCATCTTCAGTAGCGGTTCTCTCCTCCACGAC
GAACGGTTCAGCCCGAGCGAAGGAATTGTGAGCAAGACGGATCTTGTCACTGTTAGAGATTGCCAGTCCCTTGAGATCCGACGGAAAGTCGCTTGTGAAG
GCCTTGAACTCAGCTAAAGTCTCTCCGAGCTCGATGTCCTGACTATTCAGCAGAATCGACAGGATGGCCTGCGTGGCGCAGGCGTTGCTGATCACTTGCT
TAGCGAAGAAAAGTCCATCCTCTTCGCTGGCAAAGACTGGGGGCTCGGCGGCTTCGTTCTGGCTGCTTTCATACTTAAACAAGAACACCAGGCCGTAGAC
AGGGGACAATTCGGCGAACTGCTGTTCGTCCAGCGTGTAGAGCTCCTCCACTTGAACGCCCTTGACGCCGATGTCCTCAATGAGGGCGGTGAATACGCCT
GTGGTGGGTTAGAAGCGTCAGATTGAGAGGTAACCCATGCGCGGAGAGGACGTACCAGGGTCGGACTCGATGGTGCACCACGACAT