Description :
From Genome Similarity Track
Location :
Scaffold_513:12567- 14086
Transcript NameFunction/comments
Phyag_g6298conserved hypothetical protein

Sequence
1519 bases(100 bases per row)
GCTATGGACCTCAcggccgaagacgacgacctgCTGAGCTACTTCCTGTCGGCGGATGTGGCGGCGGAGCAGGCGCCGCAGACgcgcgcagctgcagccg
agCAGTTCACGCTGGGCCAGACCGTGCCTTTAGCCTCGGAGCGGACGTTCGGCAGCGAATTGACGCCTTCCTCCACGCctggcaacagcagccaagCCGC
GTCCTCGCCGGCCTTCAACCAGTCAGCgcagagcagcttctccgagAGCTCCTTGCTGCGTCCGACTGCAGCCAACGATGACGAGACGTCGTCGACCACG
GGGGTGCTggactcggacgagaagcggcagcgacgactggCCAGGAACCGCGAGTCGGCGCGTCAGAGTCGCCGCCGTAAGAAACAgtacttggagctgc
tggaggagaaggtgtcgcAGTTGACGGAGAGCATCGACACGACGCGTGCGGGCCACTTGGAGCGCGCGGATGAGGCGCTGAACCAAGTGCGCTCGGATAT
CCTACAGAGTCTCGCGGACGACAGGAAGAATGGAGGCTCGGAAGGGGTAAGACGACATTTTTTACTATTGTTATTTAGTGGTGGATGAGCTGAGTTTGCT
GACATTTTTGACTTGGTTTTACTTTTTTTGTCTGTGAAGAATGTGCAGGAGAAGATTCGACAGGGGATTATGCTGATTCAGGAGCGCTTTGGACCTAACA
GTGTTGTACGTTTGATAttttttgttgctgtggacTTCATTCTCGTAGTTTTAATTCGTTTTTATGATGTTGTTTTAATTTGCAGGAGCGACTTGCTGTG
AAGGACTATAATTTCCGCCAGCTCGACaacctgttgctgcctcCGTACTGCCGGTTCTTGTTGTGGCTCAGTATTCAGGACGAATCGTTCTTTGATGAAG
CCAACGGATTGAAGAACGGGGTTGGTGACGCGCCAGAGAAGAAAAAGGCCCCCGTTatggtgaagaaggacaCGCTGTGGTCGACGCTGACTAGCGACCT
CGCGCTCACCTACGAGCAAgatgagaagctgaagtcgCTCTACAAGTACGTACGGTTGGAAACTCTATTTTTTCATTCTGTTCGCGCGCTAATGAAAAAC
TGCTGTGGTTTTGCTGCAGGTCTGGCGACTCAAAGAGTAGCAAATCGGAGCGCCGACGGGTGGCAATGGCTGTGGTACGACCAAAACTGTTGCGAGTTTG
TTGATTTTACTGGGCTCGTGGTGCTTACTTTTATTCGTTGTTGTATAGACATATTTAagcaagctgaagaagagccTAGAGCAGCGCTCGGAGGCTGTCC
AGCGGCAAACGGAAATTCTGCACTCCATTCTGACTCCGGAGCAGTCGCTCACATATCTTCGGTGGGTGGATGCCAATCAGGAACGACTGCCCCATTACGT
GGATAAGACTCGGGTGGTGTCAAACACAGGAGCTTCCGACGCGGTGCGTACCATCCTGAACAAAGACGACCGCGATCTTACGGTGGAAGACGTGACTGCA
CTGCTGGGAGAGCTCTAGT