Description :
From Genome Similarity Track
Location :
Scaffold_107:12567- 13857
Transcript NameFunction/comments
Phyca_LT1534557323serine protease family S10, putative

Sequence
1290 bases(100 bases per row)
ccgttgcgacggggactcatgacgacgaggtcttctgcgggctcacgacacaggattcggggtacattaaactccctaacaaggtcgatgaccactactt
ctactggtactttgagtcccgcagccaaccagccactggcccacttgtactgtggctcacgggaggacctggatgttccagtatgatggctctacttacg
gagaatggaccgtgccacgttctcccggacctgtccacgaaactgaatccgtactcatggaccaacgagagcaacgtcgtatggctggatcagcccacga
ccgtcgggttcacttacggagatgaagaagatgccgacaacagtgaagagaacgtgggcgagaatatctactacttcctccagggtttcttcgagaagca
cccggaactggctggtcgtgacttctacattaccggcgagagttacggtggccattacgtacctgtggcagcacactacgtgtggcagaagaacaaggtg
aacactggtacttcgaagtttattaacctgaagggtattgctataggtaatggacttacgcaagcttcgatccaaatgccacactacatcgatatggcaa
ttggcaattcgtacaacatttcgctggtggatatggctcagttggacgagatgaaggcggctgtacccgtgtgtatctctgtattggagcagtgtccaca
aaatttgaccgcgtgtggatacggagaagatttttgcatggaaaagctgtttgaaccaatgctcaaagctgatcgaaacccgtacgacatccgtttgcct
tgcaaaaacaccggtgatgacactgaatgctacgacatgtcgtacgtctccaagtacttggacgcgccaaatgtacgtaaagctctcggcgtggactcga
agcgtgtaggtgcatggcaggagtgcaacgcaaaggtgtatgaagcttttctaaagacagctgaccccgccaaaccattcaacgtgtacgttgcggacct
gttgaacgatgatgtgcgcgttctcatttatgcgggcgacgctgacctcgtttgcaactggtacggcaacgacgcctggacccgcgcattgcagtggaag
ggcagagatgaattcaacgtagcaccggaaaagcccttcattacggctgatggaacaaatgcaggtgtgacgcggtcatttaaccagtttacattcctgc
gtgtattcaactcaggtcacatggtacctcaagaccaaccagcagtggctctttacatgctgaacacgtttttgaagaacgaggctttct