Description :
From Genome Similarity Track
Location :
Scaffold_292:125656- 126673
Transcript NameFunction/comments
Aphin_H310_08601predicted protein
Aphin_H310_08602herpesviridae ul52/ul70 dna primase

Sequence
1017 bases(100 bases per row)
GTCCACGATGTGTCCCAGCACCTGCTTCTCGTGGTCGGCGGCACCGGCTACGTCGGCAGCAACATTTTACAACGTGCCGTACAGAAAGGCATCACAGTTC
GCAGCTTGAACCGCGGAGGTCGTCCAGCATGGGACAACACGCCATGGCTTGACAAAGTCCGTTCCACGCTGCATCCGCGAACCCACGTCATGACGATGAG
TTGATTCTGTCTAGGTGGAGTGGTTCAAGGGAGATGTCTTCTCCAAGGATGACTTGCAGAAGGCTGTGGCAGGTACGACTGGTGTGTGCCCAAAGGAGAT
TGCTGTGAATCGTGCGTTTCGTGCCAGGCACGACGGGAGTAATTTCGACTGTTGGTGCATTTGGAAGCAACGAGCACATGCAACGGTTTTGTGGGGACGC
GACGATCGCTGCCGTCCGTGCGGCCAAAGAAGCAGGTGAGTGACTCCTAGTCCCTCGCGCTTGGAATGACGACAATGATTGCATGGCCGTATCCAGGGAC
AGAACGTTTTGTGTTCATCTCGGAATCCCGAGTCGGAAGCAACATTCCCAAATGGGCGCCTTTGTACGGCTATTTTAATGGCAAAGAACGCGCCGAAGCG
GCGGTTCGCGCCCAGTACGTACAACACCGCCATCCTCCGCGAATTGGACAATCTGACGTCAATCTGGCAGCTTCCCCGACACGGGTGTGTCCCTCCGTCC
TGGATTTGTCTATGGTACCCGTCGAGTGCACGTGAACAACACGGATTTGTTCTTGCCGCTTGGCCTTTTGGGCGCCCCTTTGGCGTTAGCTGGTCGTGGA
GTACGTCCTCTGGTTTTGTTCAACTGGATTTGAACTCGATCTGTAGTTGGGCCCGGTGTCTTCGATGTTGTCGCGTGTACCTCTGCTCGGCCCCGAACTC
CTGGCAGTGTGTCCGGTGGGTGCCCTCGCCAAGGCCGCAGTCTTGAGCGCCATCGCACCTGTCCATGGCGACGTCTTGGACACGACCAACATCATTGCGC
TCGGCGATTCCTTCCAC