Description :
From Genome Similarity Track
Location :
contig_1:125643- 126644
Transcript NameFunction/comments
g19.t1hypothetical protein

Sequence
1001 bases(100 bases per row)
AGCTCCGAGATACGTCCATGGGCCCGTCAACGCCGGGGCCGAGTGGATGGCGATCTTGTTGCCCGTGGAGAAGCGGAAATAGGTGCCATCATCGCGCCGA
ATAATGGACGGGTCGTGGGCGTTGGTGCAGGTTCCGGTGCACAGCTTGGGGTTGGCATACCCGTTGACGAGACCAGCGCCGAGCAGTAGGAGAACGAGGA
TCGAGAACAGCTTCATGGCAAAAGAGTCGAGACGATCAGAATCGAAAGTGCTATTATAACTACTGCACACCTAGGCGGCCGGTAGAGGACTCCGAGTTTG
TACGCCGTGTGTGCCTCCATAGCAAAGAGAGGTTTTGCATGAGCTGTTACCAGCTGCATTGTTGGCGATCACGTCGTATGAAGGTGCCAAAAGCGTAGGA
TGTTTTGACCGGCATCCATGACGACGACACGCGCGAAGATTCATTGGGAGACCTGGTCACCAGCAAGTTGCTGCTGGCAGCAACGGAGCAACTATCAAAC
TGCACTTCAACAAGCTTGAAGCATTTTTCTGTACGAATCCATTTGCTTTGATGTGTGGTTTCAAAAGGAAGACCACGATGTAGAGGTCAGGTCCAACACA
AGGATGCTACAGTCTATTGCATCAAAAACGAACCGCACAAAGACACAAAGGTGAGCCACGGTCATCACGACGAAGTTATCGCGATGTACGTCTTGAACGA
TGAGGCTGTTGGTATTGACTTAGTTGTTGAAACTGTACGACAGCGACTTTTGCACGGCTACGGTGCCTACAGAAAACAAAATACATGTACATCTACTGGT
AGTGTGTATGCGATGCTTCTTCACTCTAGCGCATCGCCACCTTAGTTGAGCACGCCGATGCCGAAGTTGTTGGTGGTCTTGCTGTGCTTCTTCGCCGCGC
TCGGACTGTAGCTGGAGATGGCCGAGTACGACTTTGCCGTGGATAGAGCCGTCGCACCGTTGCGGGACTGAAACGCTCCGCTGTTGTCTACCACGTTGGC
G