Description :
From Genome Similarity Track
Location :
contig_1:125642- 128501
Transcript NameFunction/comments
g19.t1hypothetical protein

Sequence
2859 bases(100 bases per row)
CAGCTCCGAGATACGTCCATGGGCCCGTCAACGCCGGGGCCGAGTGGATGGCGATCTTGTTGCCCGTGGAGAAGCGGAAATAGGTGCCATCATCGCGCCG
AATAATGGACGGGTCGTGGGCGTTGGTGCAGGTTCCGGTGCACAGCTTGGGGTTGGCATACCCGTTGACGAGACCAGCGCCGAGCAGTAGGAGAACGAGG
ATCGAGAACAGCTTCATGGCAAAAGAGTCGAGACGATCAGAATCGAAAGTGCTATTATAACTACTGCACACCTAGGCGGCCGGTAGAGGACTCCGAGTTT
GTACGCCGTGTGTGCCTCCATAGCAAAGAGAGGTTTTGCATGAGCTGTTACCAGCTGCATTGTTGGCGATCACGTCGTATGAAGGTGCCAAAAGCGTAGG
ATGTTTTGACCGGCATCCATGACGACGACACGCGCGAAGATTCATTGGGAGACCTGGTCACCAGCAAGTTGCTGCTGGCAGCAACGGAGCAACTATCAAA
CTGCACTTCAACAAGCTTGAAGCATTTTTCTGTACGAATCCATTTGCTTTGATGTGTGGTTTCAAAAGGAAGACCACGATGTAGAGGTCAGGTCCAACAC
AAGGATGCTACAGTCTATTGCATCAAAAACGAACCGCACAAAGACACAAAGGTGAGCCACGGTCATCACGACGAAGTTATCGCGATGTACGTCTTGAACG
ATGAGGCTGTTGGTATTGACTTAGTTGTTGAAACTGTACGACAGCGACTTTTGCACGGCTACGGTGCCTACAGAAAACAAAATACATGTACATCTACTGG
TAGTGTGTATGCGATGCTTCTTCACTCTAGCGCATCGCCACCTTAGTTGAGCACGCCGATGCCGAAGTTGTTGGTGGTCTTGCTGTGCTTCTTCGCCGCG
CTCGGACTGTAGCTGGAGATGGCCGAGTACGACTTTGCCGTGGATAGAGCCGTCGCACCGTTGCGGGACTGAAACGCTCCGCTGTTGTCTACCACGTTGG
CGGCGCAGGAGCGACCGAGGTAGCTGTTGCACTCGGTGGTGGCGGTGGCGGCGTAGAGGGCGCCATCCGAGCCGGTCAGCAGCGGCAGCGTCGTGTCCTG
GAAGTAGTTGCCCTCGGCGAGCACCCATGCGTTGACGCCGATCTCGAACGAGTGGCCCGAGTTGTCCGCCCAGTAGTTGTTGGCGATGTGCGCGACGACG
TTGGCGCTGCTGTCGCCACCGATCTTGGGCGAGCGTCCCGATGTTGAATGAACGTAGTTGTTGAGCATGCTGAAGCGGGTGTTCTTGCCGTAGAAGATGA
AGGACCAGTAGTGGCGACCGTCACACGTAGCCGAGTAGTCCGTGCGGCCGTCGAAGTCCGAGTTGCTGATGGTCATCGTGGACACACTGGCGGCGTTCGT
CGTCAAGAACTGACGGCCGACGTGGGAGACCTTGATGTGGTCCAGCCAGATCTTGTTCATGGCCGTCGAGCCGCCGTTGCTGCCCTGCATGTAGAAGGCG
TCGCCACCCCACACCAAGTGGCGGTTGAGCTCCGTGATGTGGATGTTTTGCACGATGATATTGTCGCCGTTCAGCCACAGACCCTTGCCCATGATGACAC
CGCTCGTGCCAATGCCGCGGATGGTCTTGCTGCCAGTCACCGTGAGTGGGGTGATGGCTGCGTTGTCGTACGTGACCGTCACGCTGGTGCCGTCCGAGCA
GCCACCCGTGTTGGACATGCCACCGCTCTGCAGGATGACATCCTGGCTCTTGTAGCCATTGTTCTTGGCGATACACTCCCGGGTGTAGTCTGGGCGGCAA
CCAGCTTCGGTCGTCGTGCCCTCCGTGCCGCGGAAGTCGAACGTCTTGTTGAGCACGATGACACGGGGCACGGCGTCCTTTAGGTACGCGACGAGCTGCG
CCGTCGTGGTGGGGTACACGGGGTGGCGCTGCCTCCGCCTGTGGTTCCGGCAGCGAGACCGGTGGCCGATCCGACCGTGAAGGCGTCCGTGGCCTGGACC
ACGATAGCCACCACCACAATGAGAATGGGACGGAAGAACTGCATTATCGCGAGTGTTTGGAGGTTCGTGAGCGGCGTGAAGCAAATTGGGGAATGACATG
CTGGTGGCGGTGGCAGACTGCGGAGCTTGTTGTAGTGTCCCGCTGTTAGAGAGGGTGCGGCTGCCCGAAGCGATCGTATCGGCACGGGCGAGGACGCCCT
GATCGGGTTGCACACGCGCTGGGTGCATCTATTGAGCTCGGATGATCCATCTGCTTTATCGTGGATGTCATGCGACTAGCAAGACGGTATCCTGTTCGAT
TTCGCCATCTGCCACTCCGACATGGCGAAATGGAGAGACCAGGCGGCGGCGTGCTGATGCACCGCTCGATTGAAGTGAGCGTAAAACTTGACGCCCCTAG
GTGACCCCAACAAAAACACTATGGTTACAGCGGAGGGATATGCGGTTGGACCAGACAGTTGTGGCGTCGAGTTGCTTACCGGTACGTGTATGCAGGTGAC
ATCGATGGTTTACACACATCCTAGGGTACCGATGTTTTATACAAGTTTTGAATGCTGCGAGGATGTGGCACTCGAAATGCCCAAAGCTACGAAGGCATCC
AGACTGGCGCAGGATGCAATCCACTGGGGGCAATCAACGTGCTTGGTTCGTTGCATTCATCTTTGCAGCCCTTGTTCCAAATACACTGTATACACACAGT
AGGGACTTCCCATGAAAACGAGTTGGGGTGCAGTGTGAACTGGCCATAAAACGGGTGTGGAGTTCTGCGTAGACCTCGGTGGCTTACGAGACGCTGCTCG
GCTGCTTGCTTCCCAGAGCGTTGAGTAAATTCTACAATTTTCAGCACAAAAGTGCAACG