Description :
From Genome Similarity Track
Location :
contig_1:125613- 130982
Transcript NameFunction/comments
g19.t1hypothetical protein
g20.t1hypothetical protein PHMEG_00041381

Sequence
5369 bases(100 bases per row)
CAAATTAATCTTCGAGCCAGTGGGCACTGCAGCTCCGAGATACGTCCATGGGCCCGTCAACGCCGGGGCCGAGTGGATGGCGATCTTGTTGCCCGTGGAG
AAGCGGAAATAGGTGCCATCATCGCGCCGAATAATGGACGGGTCGTGGGCGTTGGTGCAGGTTCCGGTGCACAGCTTGGGGTTGGCATACCCGTTGACGA
GACCAGCGCCGAGCAGTAGGAGAACGAGGATCGAGAACAGCTTCATGGCAAAAGAGTCGAGACGATCAGAATCGAAAGTGCTATTATAACTACTGCACAC
CTAGGCGGCCGGTAGAGGACTCCGAGTTTGTACGCCGTGTGTGCCTCCATAGCAAAGAGAGGTTTTGCATGAGCTGTTACCAGCTGCATTGTTGGCGATC
ACGTCGTATGAAGGTGCCAAAAGCGTAGGATGTTTTGACCGGCATCCATGACGACGACACGCGCGAAGATTCATTGGGAGACCTGGTCACCAGCAAGTTG
CTGCTGGCAGCAACGGAGCAACTATCAAACTGCACTTCAACAAGCTTGAAGCATTTTTCTGTACGAATCCATTTGCTTTGATGTGTGGTTTCAAAAGGAA
GACCACGATGTAGAGGTCAGGTCCAACACAAGGATGCTACAGTCTATTGCATCAAAAACGAACCGCACAAAGACACAAAGGTGAGCCACGGTCATCACGA
CGAAGTTATCGCGATGTACGTCTTGAACGATGAGGCTGTTGGTATTGACTTAGTTGTTGAAACTGTACGACAGCGACTTTTGCACGGCTACGGTGCCTAC
AGAAAACAAAATACATGTACATCTACTGGTAGTGTGTATGCGATGCTTCTTCACTCTAGCGCATCGCCACCTTAGTTGAGCACGCCGATGCCGAAGTTGT
TGGTGGTCTTGCTGTGCTTCTTCGCCGCGCTCGGACTGTAGCTGGAGATGGCCGAGTACGACTTTGCCGTGGATAGAGCCGTCGCACCGTTGCGGGACTG
AAACGCTCCGCTGTTGTCTACCACGTTGGCGGCGCAGGAGCGACCGAGGTAGCTGTTGCACTCGGTGGTGGCGGTGGCGGCGTAGAGGGCGCCATCCGAG
CCGGTCAGCAGCGGCAGCGTCGTGTCCTGGAAGTAGTTGCCCTCGGCGAGCACCCATGCGTTGACGCCGATCTCGAACGAGTGGCCCGAGTTGTCCGCCC
AGTAGTTGTTGGCGATGTGCGCGACGACGTTGGCGCTGCTGTCGCCACCGATCTTGGGCGAGCGTCCCGATGTTGAATGAACGTAGTTGTTGAGCATGCT
GAAGCGGGTGTTCTTGCCGTAGAAGATGAAGGACCAGTAGTGGCGACCGTCACACGTAGCCGAGTAGTCCGTGCGGCCGTCGAAGTCCGAGTTGCTGATG
GTCATCGTGGACACACTGGCGGCGTTCGTCGTCAAGAACTGACGGCCGACGTGGGAGACCTTGATGTGGTCCAGCCAGATCTTGTTCATGGCCGTCGAGC
CGCCGTTGCTGCCCTGCATGTAGAAGGCGTCGCCACCCCACACCAAGTGGCGGTTGAGCTCCGTGATGTGGATGTTTTGCACGATGATATTGTCGCCGTT
CAGCCACAGACCCTTGCCCATGATGACACCGCTCGTGCCAATGCCGCGGATGGTCTTGCTGCCAGTCACCGTGAGTGGGGTGATGGCTGCGTTGTCGTAC
GTGACCGTCACGCTGGTGCCGTCCGAGCAGCCACCCGTGTTGGACATGCCACCGCTCTGCAGGATGACATCCTGGCTCTTGTAGCCATTGTTCTTGGCGA
TACACTCCCGGGTGTAGTCTGGGCGGCAACCAGCTTCGGTCGTCGTGCCCTCCGTGCCGCGGAAGTCGAACGTCTTGTTGAGCACGATGACACGGGGCAC
GGCGTCCTTTAGGTACGCGACGAGCTGCGCCGTCGTGGTGGGGTACACGGGGTGGCGCTGCCTCCGCCTGTGGTTCCGGCAGCGAGACCGGTGGCCGATC
CGACCGTGAAGGCGTCCGTGGCCTGGACCACGATAGCCACCACCACAATGAGAATGGGACGGAAGAACTGCATTATCGCGAGTGTTTGGAGGTTCGTGAG
CGGCGTGAAGCAAATTGGGGAATGACATGCTGGTGGCGGTGGCAGACTGCGGAGCTTGTTGTAGTGTCCCGCTGTTAGAGAGGGTGCGGCTGCCCGAAGC
GATCGTATCGGCACGGGCGAGGACGCCCTGATCGGGTTGCACACGCGCTGGGTGCATCTATTGAGCTCGGATGATCCATCTGCTTTATCGTGGATGTCAT
GCGACTAGCAAGACGGTATCCTGTTCGATTTCGCCATCTGCCACTCCGACATGGCGAAATGGAGAGACCAGGCGGCGGCGTGCTGATGCACCGCTCGATT
GAAGTGAGCGTAAAACTTGACGCCCCTAGGTGACCCCAACAAAAACACTATGGTTACAGCGGAGGGATATGCGGTTGGACCAGACAGTTGTGGCGTCGAG
TTGCTTACCGGTACGTGTATGCAGGTGACATCGATGGTTTACACACATCCTAGGGTACCGATGTTTTATACAAGTTTTGAATGCTGCGAGGATGTGGCAC
TCGAAATGCCCAAAGCTACGAAGGCATCCAGACTGGCGCAGGATGCAATCCACTGGGGGCAATCAACGTGCTTGGTTCGTTGCATTCATCTTTGCAGCCC
TTGTTCCAAATACACTGTATACACACAGTAGGGACTTCCCATGAAAACGAGTTGGGGTGCAGTGTGAACTGGCCATAAAACGGGTGTGGAGTTCTGCGTA
GACCTCGGTGGCTTACGAGACGCTGCTCGGCTGCTTGCTTCCCAGAGCGTTGAGTAAATTCTACAATTTTCAGCACAAAAGTGCAACGTTTACAAACTTC
TACTCGACAACGAAACTACATGGCATGCAGTACATCTGTCTACAATGCCACCAGGTTACCTCTACTGGTAGCCAAAACGTTTCGTTGTCCGTCGCGGCAC
GACTGTGAAGACCACCAACTACATCAATGTCTGTTGGCGGAACAGGTAGTAGTGTGACGGTCGGTAGTACCTACGACCTGCCTCTATGGAAACCTTAGCT
AGACGCAGCAGCATCCAGTGTGTGGTGGCTCAAGTCGAGCACCATCATCAAGTTGAGTGGCGTGCTTGAACTTGGACGATCAGCAATGGTAGGTAGGGGC
TGAAACATTCATTGATTTAGTTCAGTTCACAATAAGCAACCCAGCGAGCAATACACTCATTGACCGTTATTTACCTAAAAAACGTTAAATTGGTGTTCCT
ATCGCCATGTTGGGAATAGTACCAAAACCTTAATTCGTAAGTCCTCGGTGACCCCATTCAGCCTTCAAAAATAGCATTCTCGTCTTCGTGACCTTGTCTG
CGTCGTCCCTGCCCACCTATGTAGCCTATCTGCGTTGTTGATGCCCTGCTAAAGTGTTTCATGCCTCACCAATCAACACCGTATTCTCAAATAGTCTCCC
CAGTCACTACAAGCCCGCAACCCTCCGCTTAACCTCTCAAGCCTCCGCTCCTCGCTTCTCGTGCTGCTACACATATTGAAGCCGCAACGAACAATGAAGT
TCCCAGGCTCCCGATACTACTACAAGAACAAGAGCACCAACGGAACTCGCTACTACGTGTGCAGCAAGAACAGGATCTGTGGATGCAAGGCGCGGCTAAT
TGTGCGGCGAGTACATCGGACAGCGAGACCGATGAATCGTCTCTACGGGCGAGCACACATGTACTCGTGTGACAGCTCGAGAGATTGACGTGCGAGAGGA
AATGCGTGAGATGATCGAAGTGCATGCACTGGAGGAGCACCGACTCCCACCTTCTCGTATTTGGGCCAACGCCCGTGACAAGATGGTGCGCAAGTATGGT
GAGTTGGTCGGAGTACAGTTTTTCGCCAAGACGGAGTGTAGCGGGCTACACATTCGGTTCACCTCCTACCTTAGTGCAACATGCACTAAGGCATACATTC
AGGTGACCACCACAGGGTGGTCCACATTCATAGCAAAAGGCATATGACTGGTAGAAAGTAACACCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGT
TCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTACACCAAAGCTTC
GTTTGGTTCATTTATCTAGGTTTAAGTATACTTGTGGATACAAGTATACTGAACTTAAGTAAATTACTCCTACGCTTCCTCCTACACGTGCGCACACGTG
TAAGCTTAAGTAGTGGGTCTAAGCAGACCCATTACACCTGGTAGCACTTTGTAGTCCGTCCAACGACCGACTAACACGTTCGTATGGAATACGAACGCGG
GGCTGAGAACCTGCCCTCGGACAGTAACATGTCCGTGGGTAGCCCAAACACGTCTGCAACGCATGTTGCGCGTGCAGACTGCCCCCACCTGTCGGAACCA
GAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGGGAAGCGGCGGTAGCAACGATGTTGCGAACGCTATCACCGACGGAGCAACACGGTGTTGCTC
TGGGTTTCATCGTGAAGGAACAGCGTGAAACCGCTGCTCGAACTTCGGTGTCGCCATCGGCCACACCGCGCGTGGAGTCATTGAAACTCCACGTAAGCAG
CTACGTTGGAAGAGAGGGCGAACCTCTCCTCCGTTGGCTTGTCGAGGTCGACACTGCCATTACGGCTCGACGTATCGTCGACCCGTTGTCGAAGGTTGCG
TTCGCCATGTCATGTCTTGGCGGACGAGCGAGGAGTTGGGCGTACGGACGCCGACTCACAGATCCTACGTGCTTTAGCACGTACGAAGAGTTCAAGGAGG
AGCTCAAACTAGCGTTTGAGCCCCCGCAGAACGAGTTCCGATCGAGGGCGGAGTTCCTCGATCTGCAACAGGGCAAGCATGACGTGCATGCTTACGCCCA
AAGAGCACGGTACTTGGTCTCGAACATCGTGACCAACCCGATTGACGAGGCGACAAAGGTCGTCACGTTCATGAAGGGCCTTAGAGATGGGCCTGTGAAG
ACCTATCTCTTCCGAGAGTATCCAAATACTCTCGAGGCTGCAATTGCGCTTGCAATGCAAGAAGAGTTTAGCCTGCGGCAGGCTAAACTGCATGTGAACG
CCCCACGGCTATGCCACGACCGGTGGCAAGGCCGTCGGGAGGTCCCGAACCAATGGACCTCTCGAGTGCGACCGCTGCTGGTTCCCAGCAGCGTCGTGGA
TCAACGAATGTGCGTTGTTTCCGCTGCGGAAACATCGGTCACTACGCCCGCGAGTGCACAGCACCTGTG