Description :
From Genome Similarity Track
Location :
Scaffold_358:125604- 126622
Transcript NameFunction/comments
Aphin_H310_08025ABC transporters ABCA family

Sequence
1018 bases(100 bases per row)
TGCGGGTTGCGGAAGACGTTTGCGACAGAAGATGGCGTGGCCAAAGTCGCGGTGCATTCGCTCAACTTGACCATGTACGCCGGTCAAATCACGGCACTCT
TGGGCCACAACGGCGCTGGGAAGACGACAACAATTTCAATGCTCACAGGGTTGTACCCGCCCTCGCGCGGCGACGCAACTGTCTTTGGCAAGTCCATCCG
CACTGACATGGACGAGCTGCGGGGGTACATGGGAGTGTGCCCCCAACACGACGTCCTCTACGATGACCTGACAGTCCACCAGCACCTTGAGCTGTACGCG
ACGCTCAAAAATGTGCCCGCCGACGACGTGTTCAGCCAAGTCAACTTGTTCATCCAAGAAGTCGGGCTCACGGAGAAGCGCCACGTGATGGCCAAGAAGC
TGTCGGGCGGACAGAAGCGCAAGCTGTGCGTGGCGATTGCGCTGATCGGCCACAGCCGCGTAGTGTTTCTAGACGAGCCCACGTCCGGGATGGATCCGTA
CTCGCGACGGTATGTCGCAAAAGTGTGGTTGGCATACGCTTTTCGTTCCAAAATGAATGGCTCTCAGCGATCCAACGGCTTTGATCGACACTTGACGGCA
ACTTGGCTAGGTTTACGTGGAATGTGCTGCAGCAAAACCGCGCGGACCGTGTGATGGTCCTGACGACGCACTTCATGGACGAAGCGGATTTGCTCGGCGA
TCGCATTGCCATCATGGCGGAAGGTCGCCTCGTTTGTGCTGGCACGTCGCTCTTTCTCAAGAATTTGTACGGGGCGGGCTACAACTTGACGTTGGTCAAG
GGCGATTTGTGTGACACGACTGACGTTTTGCAGTTTGTTCGGCAATTCGTGCCGGACGCGGCGGTTTTGAGCACGGTCGGGTCGGAGCTCGTGGTGCAGC
TGCCATCGTTGTCGAGTGGAGCGTTCCCGGCTCTACTTGACGGCCTGGACCGCAGCTTGACTGCGCTTCGCGTCCTGGAGTACGGCATCTCGGTGACAAC
GCTAGAGGAAGTATTTCT