Description :
From Genome Similarity Track
Location :
Scaffold_178:1256- 2294
Transcript NameFunction/comments
g5336.t1hypothetical protein

Sequence
1038 bases(100 bases per row)
CGTGCGCTTCGGGAGCAGCAGCAGCGCGACAGAGAGCGATGGCCCTGTCGGCGCAGCACATGCACCACGTGGTGCATGCGGCCCTCCACCAGAGACAGCG
CGGAATGCGGCTGTCTCCGGTCATCCCAAGCGAACGCCAACGACTGCGAGAGTCGTTGGAAGAAGATGTGAAACGAATCAGCAGGGCCTGGTTCAATCCG
ATTCGAGAGGGTCTCGAAGCGTCCGGGGCGACGCGGTAGTGTCGACAGGTAATGTCGACACACAATTGGTCGAAAGACACTCCGTCGTTAGGCGTAGAGG
TAAGAAGACGCGTCGGCTCTGGGAGCCGACGCTGCAAGCAGTGCGGACGGTTGCAAACGTCCCGCACCGGAGATGCTTGCGAGCTCGCGTGCAGCCGGGC
TGCACGACGAAGCGGTGCGCGATCAAGCCGGGCTTGAACGCGTGCGCCCGCGGGTAGAACCCGCCGGCGAATACAAGGAACAACTGTCCACGGCCAGGCC
TGGACAAGAAAAAACTCGCGGAGCCGGGCTCCGCACGAGAAGTGAACGGCGCAAGCAAGAAAAGCTGCGCAAGTCTCGGTCAGGGACCGAGACGCTACAA
GCAGTGTCTGCCGGGCAGACACAGGAGTTGGAGACGACCGTCGAGACATTGAATGTCTTGACGCGTACGAGTATTGGTCTCCAATACAAGAAGATGAGGC
TGAATAATCCTCCGACGTTAGCGTCGGAGTTGATGTCGCTCCCAGTCACAAGCTAGAGCTGAATCAGCTCATCTCTGAGGTCGCGGACGCCCTCAGCGCG
AAGTCGAAGTAGGAACGCTTCGACGAGCAAGGCTGGGACTCGCTCAAGGCGAGCCCCTTTTACAAGGTCTTGGGTGAGTACAAGGATGTACTCCCGGACG
ACATTCCTGCGGAGTTACCGCAGGATAAGGGTGTTCAGCACGAGATTGATCTCGTGCCGGGAACGAAGTACTGCGTCACGCAACAGTGGCCACTGCCGCG
TGAGCAAGTCAAGGCAATCGACGACTTCTTTGAAAGTC