Description :
From Genome Similarity Track
Location :
Scaffold_7:125597- 126614
Sequence
1017 bases(100 bases per row)
TTTGTAACAGAGCGCTGCCTATGGCAAAGTCGGATGCATCTCAGACAACACTGAAAAGGTACTCAGTATTTGGCAACGGCAAAATTGGAGCATGGAGGAG
ACTCTCTTTTATTACCCGAAATGCGTCGGCATGGGTATTTTCCCAGCGCCAATCGGTGTCCTTCTTAAGGAGATCAGGTAATGGCCGAGCCATATCAGCG
TAATTTTCACTGTATTTGTGTAAATAATTGGCAAGGACAAGCCACTTACGCAAGTCCTTTTTATTCTTAGAAATCGGCCAGTCCACTATAGCTTTGACCT
TAGCGAGATCCGCTCGAAGGCCGCGCTTACCAATGAAATAGCCGAGAAAAGGAATCTCCTCTGCACCAAAAACGTATTTAGACGCGTTAGCGTACAATTT
ATTAGTGCGCATGCACTCGAGCACGGTTCGCAAATGACTGATGTGATTTGCAGCATCTGACCGACCTTGTTCGGCACGACTATGGACAAAAATGTCATCA
AAGTACGACTGTGCATAATCCCGAGGTGGGCGGAAAAGTTGCGTCACCAGACGATTAATGTTGCCAGAGCATTAGACAGTCCTTGGGACATCACCAGCCA
TTCCCATAGCATACCACTCGGGGTTCTCACTGCTGTAAAAACGGAATATCACTCGCTCGCACGAGCAATTGATAATATCCGTCGAACAAGTCGAGTGCAC
TTTACATAGTACAACCAACCATGATGTTTTTGAAGAACATCATTTCGAGAAATGGGTGTCTGTGCCGGAATCGTAGCCGCATTAAGCTTGTTATAAGCAT
GCACAATACGCCACTTGCCGTTCGGCTTTTTGACACAAAATGTCAGTGTCGAATGTGGAGACTTACTCTCACGTACATTCCTGCCTTGTGCTTGGTACGG
AAGAAGTCATAAATTGACATCACCTTGGCAAGGCCACTGTCGTGTGACACATTATTTAGTCCCAGGAAATAAGTCAGTTTCATGATAGACACCTCTATCA
AGAGGTAGAACCGAGGG