Description :
From Genome Similarity Track
Location :
Scaffold_2:125566- 130630
Transcript NameFunction/comments
Phyta_totarag144conserved hypothetical protein
Phyta_totarag145pumilio-like mating protein M90
Phyta_totarag146hypothetical protein PHYSODRAFT_315962

Sequence
5064 bases(100 bases per row)
CGTGGACGAGCCGTCTCCGGCCCgcaagttcttcgtcaaggGAACATATAAAGACTTTGGAGATGAACCGTGGATTGGTGGCGGATATGCCTTCCCACGC
GTAGGTCAGTCGGACTCGGCTTCCGAGGACCTGGCCGCTCCTGTAGACGGCCGTATTTTCTTCGCTGGAGAAGCCACAGCTTTCGAACAGCCTGGGATGT
CTGTGCACGCTGCAGTGGATACTGGTACTCGTGCATCTGCGCAGGTTGCATATGCACTGCAGgaactgtacatgtagaatgaTACTTGAAGTAATATGGA
TTGAAGCAGTTCTCATGAAGTACAACCGAAGGCATCTTGACCTTACAGTATGTTCATTCAAAATACGACCAATTGATTATCTCTTTATTAGTTTTGGTGT
GGTGGCCCGTGTATCGTACGCTCAAAGTTTGGTCTTGGTTATTGTGCTgtctgtcgctgcagctggtctTGAACTCAAATCGGCGCGTGGTGAACGACCA
AGGATCGTTGCGCCGCAAAATATTTATATAAGTAGTGTGTGTAGGCGGGCAGGAAGCGCAGGAGCATGTTGAGGGCTGCTGTGTTGGTGCCCCACCTGTT
TGAGAGCCGCTGGTGGTGTAGCGGTGTGGTCTCCAGAGCTGCCTACTCAATAGTAGTTGTTCACCTGttcctcgcgctccagcCGGCTCAAAACGTGCTT
CCCGAACGTGAAGCGCTTCAGATAGTCCTCGTTGTGTCGAATAATACATACAATACGTTGGCGGTCGTGGTCATCCGCGCGCTCCAGCAATTTCTGCACC
ACGTAGTTCCCGTACATGTGTTTCATCATAGGAAGCAGCGCACAGGACGCTCCACTCTCGTCACACCGAAGGATGAAGTTGACGATCTGGCTGATCTCCT
CCTTCGTCGCATGCTCCAAGCAGGATTCCACGACATTGCTGGCATATTTGTGCTGGCTCCAGCGTGCGATCTCAGGAAGCACTGCTTGCATGACGATGTT
GCGTTGGTCCGGTTCGCCGTGACTGATAACGTGCTGTACGACGTAATTGCCAAACTGGTCCTTGACAAGCTCGCGGCACTTGAAGATGATCTCATTCAGC
AGCGGGCGGATTTGTTCTGGCGCGCAATGTTCCAGTACGCGCTGGATCACACGGCATCCATACGAATGCGTAGagagtgctgcagcgtgaccgacgaagc
tgtcgatgATAAACTGGATGTCCTCCCCCGTCACAAAACGTTGAGGTCCCAAGCCATTGCACTCGACCGCCCTCTTCCAAGATGCTGCCTCGATGCACTT
CTGCAGTACGTGGTTGCCGTTTTGGTCAACGACGCACTTCATCACGTGTCCCTTCAGCTGTCGAATCAGTGCGAGCTGTTCTTCAACTTGGGCCACCTCC
AGCGCACGCTGGATCACGCGACATCCGTACACTTGCAGGGCCAGACTAATCATGTTGCTTGTCATcaactccaccagcagctgctgctgttccaaAGAGC
CATACTCGAGAAACTTCTGGATCACGTAGTTGCCGAACACGTCCGTCATCAGTAGGAGCGAGTTTGGAAAGATCTCGTTGAATGCTTCGGCTTTCAAGCG
TTCGTCAGCCTTCTCCAGTTTCTGCTGAATAAATCGCGAGCCTGTCTGGTCCTTCgcgaagaggaagaggtgCCCTTTAATGGCAGACAGCCCCCATTTC
TCCGACTTCGGCGTCGAGTTGAACTCCTCCAATAGGCTGTTGGACGAATATGAGTGCGCCACCGGGTGAAAGTACTCGAAATCACTTCGCCGAGGCCCTC
CGACTTTGGGTCTGTGCAGCACCTGTGGACGAGGCATGTAGCTTCCAAAATCATGACGGTCGTACAGCGGATGGTCAACCAGGGGATACGACGGGCGAGC
TTTGAACATCTTATCCGTGGGTTTCACACCGCGGTACTCTCCAGCGTAGCCGACCGGGTAAGTCGGCATAGCCGAGCTGTGACCAGGGTGCGAGCTTGCA
AAATCCGACGGCGCATAGCCGAATGGGGACGGCTGGAACGAGTACGCGTCCTCGTTTGTAATCCACCGTGACTTGGCAGCAGCCATCATGACGGGGTAGC
CCTGAACACCTTGAGCACCCATGCCGTAGGACGAAGGATAACCTTGCGCCATAGCTCCATGGTAAGAACCACCAAAAGGAGGCTCGCTGGTGCTTTTGCC
GAACGTGTGACGGTGACCGTTCACCCCAGCAAGTTTAGGACCAGTGGCGTGCTGCGGCACCCGAGGCAAATCTCCGAAGTTGTGACCAGCACGGCGGCCA
GAATCGTAAGGTGAAGCTGAGCGATAGTTACCGAGCCTCAGCTGCCCCATTCCTTCGTTGATGCTGAACATGGACTGATCCTGCtggtctcctcctccaa
atGAAGGCCTGCGACCAGGCAAACCGCCGTCTTCAAATTGTCCGTACTCGGGTGATGGCGTGCGGGGGAAGTCCTCTTGGATTCGGTCGATCAATGACAT
CCCCGGGGGGATTCGGCAGCCTACAGTCTTGCTGTCCCCACGAGACGACCTTGCAGGGATACTCCTGGAGGTAGTTGTGCTTGAGCGCGGAAAACTTTGC
TTGTCAGGTGAAGTGGTGGGGCTCACAGTTGAGCTGAAGTCGCCGTCCTCGAAATCGTTGTGAGGGTTCTTCCAGATATCCACCGAGTGGTGGCCACGGC
TTTGAGACATCGCACTCTCGCGATCACGGACCTGCTGTAGCACAGATAAGCAGGACAATACAGTCAGAAGAAGTTCTAACGCAATGTCAAAAGAAGACAA
AACATACCAGATTCAGCGACAGACCATGTGACTCGGGCTCCTGGTTGTCTGCCGGTTGATTGTCCTGCAAAAGCAAAGCCACGTGAACCCAATGCGTCAG
AAACAAAGCTCGCTCCATTTCCAGCGGTCAAAGAGAAAAGCAAATAAGTACCTTGCTCGACAGTTTGTGCGTTGTTCCCCATGATGTCTGCAGCTCTCCG
GCGTTCTCAGATGGGGCATCGTGCTGGTCTTGGTCTTCCTTCTGGTTGTCCACCGGCACCGCCACCTCGCCTTCATCTGACTCGCTTGGCGGCGTGGTCT
GAGCACTGTGCACAGAGCGCGAGTCTGCCTTGGACTGCAGTCGTGGGGCACGCAGCGTGAAGCTCGCTGGGCGTTCACCCAGCGCCTGCGAAGCAGAGAA
GAGCAGGGAGGAGCGCGACTTGAGTCCTTCCGACGACCAGAGCGAGTCCGACGGGTACCCGACGgggtcctgcagcttcacgcgcACTGGTTCGACGGGG
TTGTCGTGATGGACGGgcttctccagcgctgcGATGGCCGATCCAGCAAGGTTGGCTGCGCGCTGCGgcggcgaggaggaggaggggcCTCTGTTGCTAC
TGCTCTTGGCGGGGCTCATCGAGTCGCTGTGACCCATGATAGGCACGCTGGCGAGCAGTTGCTGGGCGTTGAGTGCCGCTGAAGCGCCGCGAGGCCGGCA
GTCGTCCACTTGCGCAGGAGGCGGCAAGTTAGAGAATGAAGCCGTTGCGGACGCGGGCGGGTGGGCTGGGGGTTATTTTTACGCCCGATGTCAACGGCGT
GGGTGGGTCTTCTCGCTTTAAGTGAAAATGAAGGCAACCTGTCACTGGCAAAAGAAAGCCCGTTTCGCGCAAAACGACGGAAACCCTCAGCGAGGCTGAG
GGTTTCGAGGATGCGGGTTAAGCGAGTGTCTATCCTTTGGCAGCGATTGCGAGTTGCATGCAATCCTGTCTGAAGACCATCTCGATCGCGAATTTTCAAC
GACCGACGCTCGTCTGAGATGGCGGGTGTGTAACATGACCGCGCGAAACTGCGGGCTCGACCGAGCGGCTCCGTGAGCTGTGGCTGGCGCTGCCACCCGG
ACCTCTGCTTGCTGTGGGCGCAGTGGTCTGCTCGCATCGGAAATTTCAGGTCGCCCATCGATGCATGGCGCCATGCATGCGGTTCGCAGGCAGTTGGAGA
TTGCTTTCATGGAAAAATCCGAAGCACGCACGTGTCGAGCCACAGCGCTGGGAGTGATGTGGCTTGACTCGACTGATGCGGTGGTTACCAGCATTGCTGC
GCCCGCTGGGGTTTCCGTCGTCGCTAACGACAGCGGGGTCGGAAGAAAGGGTGGAAGCGCGTGCGTTATGCTACCGGCAaagttgaagcgacgcgGGACA
GCCTGGGATCGTCGACACGCGTTCTCAGAAAGGgcagtgaccatcactccgtCAAGGGGCAAGTTGCCGTGCCGTGCCATCTGGAACGCCGGCATTTGGC
AACGACACATCTTGGTGACAGGAATACGACGGGATCAACAACGCTATGACTGCTCGTCGGGCCGACGGAAGGCCGCTGCCAGGATTGTCGTAGAAGCAGC
CTGGCTAGCTAGCGAAAAAAGGTGGCTTCATCGCCTCGCGAGATCGAacggtggcggcggcaacgaAAATGCGAGGCAAAGGGCAACCAACCGCATCAGC
ACCCCTTTCGCTTTAAACACTGCTGCCGCCGTGTCGCCTTAGGCAGAAAAAGGAAATATTGGAGCCCGCTTCCGCCAGCGGATACCCACACATTCAACAA
GGACTAAACCGTGTATTTGCTTCTCGTCGGTGGTGCTAAAGCGAGTGGACGCAGGTTATACGGCGGAGCGGAATGTCAAACAAGGTCCTCGCGCGCTCGC
ATCCACACAAGGTTGTGCGTGCCCTGTCCcactcgcagctgctgactGCTTTCACAGGTACAATGCTCGGTGTGTTGTAGCTTAGCGGAGACAGCGCGGT
TGCTTGACTTTCCCTAAACCACAGACCCCAGTCGAGAGAGCCAGCAccggaagttgaagtggctggCAGGGGACACCTGAGCTGTCTACGAGCTTTTGGG
CTTCAGGGCCAGCAGCGCAACGGCCGCCACGCCGGCCGTCACCACAGACGCCGTGGCCAGCGCGCGCGTGGTCAAGTACCACGGTTCAGCTCCGTCCCTG
GTTGTTgttgccgccgcctgctgctgctttcgcTGGACCTTGGTCTTGCGTGTGAAGATAGACT