Description :
From Genome Similarity Track
Location :
Scaffold_4:1255540- 1260669
Transcript NameFunction/comments
Phyin_T30-4PITG_03277Pyruvate dehydrogenase E1 component subunit alpha
Phyin_T30-4PITG_03278Putative uncharacterized protein

Sequence
5129 bases(100 bases per row)
CAGGATTGGATGGAAAACATGATGGATAGCAACGTTGTTTTCACCCAATCGCTACAAGAAGCGTCTATGCAGATCATTTCACAAAAAGCAAGTCTAATCG
ATCTTCCCATCGTCGTCGTGGCCAAGCTTTGCCGCTGCGATCATCGGCGGCATCGCTACTGCGTGCGCTGCTGTATATATGGCTCTACTGCCACTTACAG
CGTGCGCTGCTCAATATATCCACTTAGAAGTGCAATGATTGCAGCAATACTCTCCTTTGAGCGGCATCGCTCGCTACTGCTACGCTATGACGTCGGAAGC
AGCTTTATCCATCATTTTAGTTTCTCTTTGAGGATTATATGATCCGGCGACGTCATTGGTCGAGAAAGAGAGGAAATCGCATCTAAGCGAATTCCGGGTC
CTGCGCTGTTTTGCGGCCGAGGTGAGCGCTGCTTGGACTCACTCTCCAATCCTCCTCCAAGCAGAAAGTAGTCAGCCGAGATGATGATGCTTCGCCGCTC
CGCAGCGCTGGCCCGCACCGCCGCGCCTGCCACGCGCGCCTTCAGCGCCGCCGCCAATGCCTCTGGCGAGGCTAAGTTTGAGTTCTCCACGCCTTTTGAG
CTGCACCGTACGTCGTCAACGGTCTGAATCTACAGCAATTCTTCTCTAATGCAGAGTGATGATCATTTTTTTACTTTTAAATTGCAGGTCTCGTGGAAGG
CCCGGCCGAATTCGCCGTGACCAACCGCGAGGAGATGCTGGGCTACTATGAGCTCATGTACAAGATGCGTCGTATGGAGATCACCAACGATAACGAGTAC
AAGGCCCGTACCATCCGCGGTTTCTGCCACTTGTACGACGGCCAGGAGGCCGTGGCCACCGGTGTGGAGGCTGCTCTGGACCGCAAGGACTCGTGGATCA
CGTCGTACCGTAACCACTGTATCATGCTCGCTCGTGGTGCCGAGGTTAAGGACATTCTGGCCGAGCTGTTCGGTATGTCTGCCGGTGCCACTGGCGGCAA
GGGTGGCTCCATGCATTTCTACAAGAAGGAGAGCAACTTCTACGGTGGACAGGGTATCGTCGGTGCTCAGGTGCCCGTGGGCGCCGGTCTGGCCTTCGCC
AGCAAGTACAACCACAAGGGCGACGGCCCTATGCCCTGCGCCATCACCATGTTCGGTGACGGTGCCGCTAACCAGGGTCAGGTGTTCGAGGCTGCCAACA
TGGCCGCTCTGTGGAAGCTGCCGGTGATTTTCTGCATTGAGAACAACCACTACGGTATGGGTACGTCTATTCAGCGTTCGACCAACAACACGGACTACTA
CACCATGGGCAACAAGATCCCCGGTATTAAGTGCGACGGTAACGATGTGCTCGCTGTGCGTGAGTGCACCAAGTTCCTGAAGAAGTGGTGCGGTGAGGGC
AATGGTCCGATTTTCGTCGAGATGAACACGTACCGTTACCACGGTCACTCGATGTCGGACCCTGGTGTGACGTACCGTAACCGTGACGAAATTTCGCAGA
TGCGTGCCTCGCGCGACCCCATTGAGCTGGTAAAGAAGCGCATGATTGAGGCTGAGTTCGCCACGGCTGACGAGATCAAGGAGCTGGAGAAGAAGGTGCG
TGCCGAGGTTGTCAAGGCCACCAAGGAGGCCAAGGCCTCCGGCAAGCCCGCCTCGTCCGCGGCCTTCGAGGACGTGTACATGGATGGCAAGGGCAACAAC
GAGTACCCTCCGTTCATTCGCTTCCCTGACTACGCTAAGAGCTTGTACAACGGCAAGCCCCAGCAGTAAGCGCTAAGCACAGCAACGAAAGAGGACACAC
ACAGAGCGGCGAGAGGATCACTATATTTCCTCTTAAGCGGTAGAAGCTGCGCTGCCTCGCTCTTGTTTTTTTCTTTTATTTCGGCTCGCTGCGCAGTGAA
TTAGAACCCAGCTGGCATCTTGTAGCTTAGCTCTAGGAACAGTCTCGTAAGCTATGCGAGTCCTCTAAAACCGGCTGAATATGTAAACGCCCAACAACGC
AACACACATTTGCCATTCATGCTTGGCCCCTCTTGCGTGAATGCTCCTTCCTGCCAACGCCTCAAAATTTCCTCTGAAAAGGTGGGAGAGTAGCTGCCTG
GGATATCCACATTTTCGCTTGGTATGTTGGTGGGTGTATGGGCCACAGCATCGCGAGTTTGGATGCGAACTTGTGCCGCAAACAGTGATGAACAGGAGGT
CTGAGTGTTGCCTTGGTAAGAACAGTTTACGGTGGAACACTGTAAAGTTAGGGGTGACTTAAATACTGGCTGCTCAATTCCCATGTTGAAGCTTCCTACA
ATACTTAAAAATGCAAGTTCACTGAGGTCGTGGCTCCTTCGTCTCCACGCGCGTGTACATGCTTCTCTTCCATATACTGACATCTGCTTACCTGCGGCCG
CGCATATTCTTCTACACTTATGTACTTGACCAATAACTAGTTCACGGTCGGCCGCTCGGTTTCTTGTTTTCTTCGTCACTGTCGTCATATTTCTTCCAAC
AGGTTGATGTGGACAGCGCCTTCAGCTAGAGTACAGCACGGCTCCGGCGCCCGGGGCCGCTTCGAAGTCGCTGCCGTGACGGCGGTGGCGAGGTCGGCGA
CGCACCACTGGACTCTTGCTGTTACCGTCCCGAGTCATGGGCGCCATGAGCTCGTACTCCTGTTGTAGCGCCACCACGCGGTTGTGCGATATCTTCCGAG
CTTGCTGGGCCAGATTGTTGGCGTAGTTAGCGGCAACGATAATGTTGTTGGCGCGAGCCATCGCCTCGTTAAACTCGAACTTTTCTTCGCCAGCTACTAA
AAGCTCTTGGTTGCCCTCGCATTTGGGCGGAACACGTGAACGGCTAGAGCGGGACGCGTGGAGCGGTGACGACCTCCTAATAGCGTATGTGGGCGACACG
GACGAGCTTGATGTGGTTGACTCGTCGTCCGTGTGGTCATTGTCTTCCGAGCCGTCCTCGGGCTGTCGTTCGGCATTGCCCATGCGCATTTGGTGCAGGC
GGAACGCTTCTATCGAGATGGCCAGGTCTGCAGGACTGCCACGGCGCTTAGCAGCAAAGAGGGCCTTGTTGCGCATGACGAGCCCGTCGCTAAAAGAGCG
ACTTGGAAAGCTGGCCTTGGGCACACCGATAGACGAGCCCGTAGTAGCGGCGTGAATGTCCTCGGATCCCGACGAGAATGTCTTGTACTCGATGAGTCGA
GAGCGTACGGGGTCGAGCAGATTGTCGTACGATCGGCGCTTCGCCGTCTCCTCCTTGACTTGCCCGCTGGTGACCGTAAAGCTCTGTGCTCGGCCAAGGG
TACGCTTGGTGTCCACAAAGAGCTGGTTCGTGCTGGCAGAGCTGGCTGAGCTGAGCGACGGAGCTGCTGATTGTTCCACACAGCCGGCAGTGTTTCGCGA
TGTTCGACGCGCTTTAATAACGCACGCTGTGCAGACACGAAGCTGGCGTTCGCCGAGCTCCGGCACATGGGTACTACGAACAGAACTGCACGAACTGCAA
CACACGTCGCCACACTTGAGGCAGTTGTAGCGACGGCGTCGCACACAGAACTTCTTGGAGCAGATCCGACAATGATCCTGCTCGCCCATGGGCACCACTT
GCTGAGGCAGCACGATCTCCTCCCGGCCCACACGGAAGCTCTCGGTGTATTTGAGAATGCCATTGATGCACTTTTCTACATGCGACTGGATGGCCGAATT
GGCTACCCAGGCAGGAAGGTCGCCGTTCTTGTCGAAGTTGCACGTGTACGTCATGCGCAGTTCGCCCGCTCGCTTGGTCGAGTGATACATGAAGCCAATA
AGAGGCACCAGATCGCGCGTGTACTTGGGCGACTCAGCGAGCTTGGAAAACCCCGCTGGGGTGTCCACGGATTCCATGATGCGGAAAGCTGTCATCTGTC
CCTGTGCGTCCTCGATCATATCGACGTACTCCAGCATAAGAAGGTCGCGATCCTTGGCGAACGGACCTGAGCTTTTGAAGGCGGCCCACTTGAGACCCAC
GTAGCGGTAGGGGTTGGTCGGTGTAGGCTCTACAATGTTTTGCACCACTGCACCATCAAGGAAATCGGAAGACAACATTCCCATCATCCGCTTGAACGAG
GCCGTGGTAGGCGTGATGAGCGACGCAGCGACGTCTTCGATGTCACAGGCGAACTTGCATACTGCGTGAACGTTGCAGGGAACATTAGTGGCGGCACTAG
AGGCGTCGGCGCGGAAAAGTGAGATCCCGTGCTTCTCGTGGACCAAAGTCCACGGAATTCCCCCGAGTAGATCTGTGGCTTCCAGGAGACTCTCGATCAT
GCGCTTGGCTACTGTCGTGAGGCGTTCACGGTCCTTGATGCACATTGTCTCCGCCTCGTCGGTCGGATCGGCGTCACTGTCATCGGTCCCGTCCGATCCG
TGCGAGGACCCAAAGCTGGAGAGCGAGCGAGGGGTCAATGGGGTCCCGGCAAGAGGCGACCCAATTGACGAGCTGTAGTCCGTCATGGTATTTGTGTGTA
TTTGATCGAGCACTTATTAAATTGTCTACTGGATCGTAGTCAAGAGTAGACAGAAGCAGCGCATATAGTGCTTTTTTGCGTCCGGGGTTGTCGCGTGGAG
GCTCAAATGCGAAACTGAGCGAGTTTCGGTCTCGAACCTCTGGCGTTTCTCGTCGAACGTAACAGCCCAGACCAGTCGAGTCGCCTGAACTCTATTTAGT
ACGAACGGCTAGTGTGCGGTGGCTGAGCGTCTTCTCTTCTATTTTCACTGACGTACCCTTCCCCGGTTGGGAGGTTGATCAAGCGCAAGTATCCGCCCGA
CCATATCCGATGAATATTATCCAGCGCGTTGCTGAAAATGTGTAATACCTGAACCAATACGTCGACACCGAGACAGCCCATGACGCCAATGACCAAAGCT
GATTTCGAACGTCTTTACATGGCTCCAGGTCAACTCATGTTGGCTCTGAACGCACCAACGCGCACAACGGAGCATTCCGACCAGGTTGACTCATGCCAAC
GTTCAGTACAGCACAGCTTCATCTGATTGGACTGCACACTTCAACTTGCGCTGTACAGTGCCCACGCATAAAAGATAACGACCCGACACCCTAACATACT
TTGGAAGGATAGAACATAGTCGCCAGTAG