Description :
From Genome Similarity Track
Location :
contig_86:125524- 130968
Transcript NameFunction/comments
g12906.t1XP_008896090.1 hypothetical protein PPTG_04034 [Phytophthora parasitica INRA-310
g12907.t1hypothetical protein
g12908.t1ETP34194.1 hypothetical protein F442_17455 [Phytophthora parasitica P10297
g12909.t1KUF72081.1 Myosin heavy chain kinase B [Phytophthora nicotianae

Sequence
5444 bases(100 bases per row)
TTCGTCAGGACTCACATTGTGCAATGTTGTGACTGTTAACTGTATCACTCTCGACTGTGGCTCGACATTTAGTCGACGTCCGCATTGGATCACTTAGACG
GTGTCTACGTCTTTGGCAAGAAACTACGCGTGGACTACTCGAAGCACACGAGCGTGTCGATGCCGCACGCAGACGCGGATCGCTTTGAGATCGAAAATAC
GCTCGATTTCTCGGGGTCACCACTTCACCGCTACCGTCGCCGCAGCCCGCAAGAAGCGGTCTCTCCCTGTCCGCTCCTTCACATCTCAGGCATTCCGATG
GAGCTGCAGCGCAACGAAAACGCTCTTGCGGGTCTTTTCGCGCAGTACGGCTTCGTCAAGAATTTTCACTACTTGCAGAACAACCCCAAGATGGCGCTGA
TTGAGATGGGCTGCATGGATGAGGCTATCATGGCACTTATTCGGCTTGACAACATGGCCTACCCGGACTCGCACATGCGCGTATCCTTTTCCAAAGCGTA
CCAGTTTTCTGCCGGTGGTGACGTCGGTCCTGGTCCTGGTCCTGGTCTGGCCCTAGTCCTATGTCCGGCCCTGGTGCTGATTCAGGTGGCTGGAACCCAC
CGATGCAGTCGCGCCCGAGAGATCGTAGCCGCGATCGCGGTAGTCGCAATCGAGAAAGAGGTCCACCTCCAGGAGGTGATCGAGACCGCTCGTTCCGAGA
CCGTGGCCCGCCACCACAGCGAGGTCGTGACTACCAAACGCGTGATAACAATCGCCGCCCTCCCCCGCGATACTGATTGTACTTGCTTTTCTGAGCCCTT
GAGAGCCTCTCAGCAACCTCTGGTGTTTGGATGCCGTCTTCACGTCTCCTCAAGTGCAATCTGCCCTCGACATCTTGGCCTTCACTGAAAGGCTCGAACT
AGCTGCTTAACACTGCTTTGCTGCTTTCGTTGTCCTGGTAAACAAACACGAATGCTGCCCTTGGCACAATTTTGCTGCGTACGATCTTGATTTTCACTGG
CACAATAAGTTGAAAACTATGGTTGGCCCCATCGCTATTATCAAAGTTTGTGAATCGGACAGGATTTACAAGTCCACCGCGCCACTTACATCTGCCACTA
CTGTTGGAATGGATGGTGCCCGATGTAAATCCTCCGCAGAATGGCCGGGACTGTCGTTCTGTCCACTGTGGGCTGCACCGGACCCGCCAATATGACAGAC
CTCGGCATTCCCCAAGCGTGATGCTTCTGATACAGCAACAGATACTGCTGCAGTAGCGTGCAGCTTGCGCTTTTTCTTCTTCTCCACGCGCTGGATCATT
TCCTTGTCCATGTGAAGCACATTCCAGCAGATTTTTTGGTGCTCCTCGCCGGGGTACTTGCGCGGTCGGATGCACACAGACCGTTGGCAGCAGGAGCAGT
AGTAGGCGGTGTTGCAGCGGAGCCCACGGAAGTAGCACACGGAGCAGCGGCCGTATCGCTTATCGCGGCCACAGCTGCCATACATGACGGGGAATCCATC
GGAGTCGATTTCGCGCTGCCCTAAAATCGCTACCGCTCCAGCTAGTCCACCAGCGTTCTTCCCCAAAGGGTCGGTGTGTGCCATTCCTTCCTGCTGCTGC
GATTGATTGTGTGCATTGTGCGGATTCTTGGCGGCCGCCTGCAAGTCACGTAAATGATGCCCTTCAAACATCCACAGAGCATTCATCGGGTCCTTCACCC
CATTCAGTGCCGAGTGCTCTTCATCTGCGTCAGTCAGCACGTCCATGCCTGGCGTCGTTGCCACTGGCATAACGGCAGTGGAGGACGAGGTCATTGTCAC
TGGAGCTGGCGTCGTTGGCAGCATCTCACCCAGCATCGGCGGAGCTGGAGATGAAGTTACTGCTTGCGGGGTCGACAATAAAGCAGCAGATAAACTCAAT
TCAGTGGCTGCGACCACCGCTTCGACGTCTCGAGCCGCCTGCTGTCCTGCTTCTAAAGTGCAGAATGAAAAGTGTCAACTGGTGAACTGTTGGGCCACGT
CTGCAGCGGCGTCTGACCTTCGTAGTACCGCAGTTTGGCCAGATGAAACATCTTCTCCATGCGCTGCGGGTCCAGTTTGTACGCCTGCGACCAGGAAGAC
GTCGATTTTTAGGAGACAACGCGGCAGCGAGAGAAAGGATAAAAGACTCACGCTCTCGACGAGCTTGGAGAGCTCCTCGTCGTCCATGCTCTTGAGGAAC
TTGCCCAGCGACGCCCCTGCCCCCATGGTTTACGTGGTGCCAAAAGCTTCCTGAATGGAACCTACAGATTTCTGTGATTGGTGAACTGTCTGGAATTTAT
ATTCTACACGCGAGTTTATTTATAGGAAAGTTCTTACATTTCTACTGCGATTATTGCCATAACGTTAGGGAATTTCTTCCTAGCGCACGGAGTGGGGTGA
CGCTGCCCGCCGGAACGGCCACCTCCGCTTTCAAGCCGCAGGCTATCTCGCCTCGTGGCGCTCTATGGCCGCAGTGGGTTGACAACCTGCGGACTTGAGC
CGTGTCGAGTCAAATAGGATGTGAAGGTGAAGGTGGACCGGCTGGGGCCGTTCGTGGTGTCGCGCGTCGCCGATTTGTGCGAGCTGGCGTCAGCGTGCGC
AAGGCGCTGGCTTCAGTCCGAAAGCAATAGTCCGACCGTTGGCGCAGTAATTAACGACCAAGCGCGCCGTGCCCCTACGGCTGGCGTCTCGGTATTCGCC
AGCGATATAAAAAACGAGAGATACACACGCGCTATCGGCGGCCGACACCTCGTTCCGTCTGCCGATATCCACCAGGCCCGGGGTTGTACCCAGCACGACA
ACGTGCAGAAATCAATTGGAGAGGCGAGAAGGACATACTGTATGCCCAGCAGCGTAGGGGTCGTGGGCGCGTGCAAGACGAGCTTCGTGCTCGCGCTCGG
GGCCAAGGAGGCCGTCGCCTCCGTGACAAACGCGTACCTATGGCCGCGGCCCGGCGGAAACGGGCGCAAAACGATGGTGCACATCTTGCGCGGTCGAGAG
GAGGTCCCGGACGACGACGACGACGGCGTCTTCGTGCTGCTCTTTGACCTCACGCGGCGCGAGTCGCTGGCTGCAGTCATTGCACAATGGGCCCACTTGT
CGGACGCTCCTGGCAGGCGGTTGCTGCTTGTGGGCACGCATGCGGATTGCACGAGCCAGCGCGAAGTCTCCGCGGCGGAGGTGCGCGAGATTTCAGGCGA
GTTTCACGCCTACGAGGAGGTCTGCTGCCATTCTGGGGACGAAGGCATTCTCCGTGTACAGCTTCTGCTGGCGCAGTGGACGAGCGCCGGACCGGACGTG
ATGGCGAGCGATATCCCACTAGCACGAGCCTCAATCTGCGGATACCCGAGACCTGTTGTGACAATGATGTCCAGCACGTCACACAGTTTGCCGGCGTCAC
CGGCAGGTCAGCAGAGACCTCGGATGCGTGCAGATGTATGGCTATACGACCCAGCAGAGCAAGCGTCTTCGAGCGCCGTGACGACGTCGGTGGGCGGTGA
CGTGAAGCTCCGAACGATTTCCAAGGCGATCTACGACATTCGCGGGGCGGTTGCGGAAAAAAGCAGGTCGTTGGCGAAATACCGTGATCGGCAAATGAGC
CACTGGCTTACGCGCAGCCGGTACTTTGGCCCAACGGAGAGCAGTCGGCACAAGCGGTGGCAGGAGGAGCAAAAGAAGCGCCAGCAGCAGCAGCAACAAC
AGACTCATGGGCACCACCGCTATCATGCTGGCCACCTTCGATGCCAGTCAAGTGCCCTTGATGGTTTGCAACAGCAACGCGTGCGAAGCGTAAGCCACCC
TGAAAAGGTCCAACCACCGAGCAGAAAGCCCACCACGCGACACAACACTGCACATTTGTCCAGCTCCAGCTCGAGCGAAAATGAGGAGAGCCCTGGGACT
CCGTTGGAGCGGAAATCCTTCATGCAACCTACAGAATTGGTCAAGCAACGACAGCGACAGCTGGAGGCAGATGCTGTACGACAACACAGGAAGCAGGTTG
CTCAACGCGCAATGCGGATGCAGAGGCGCGCAGCCTCTAACGACCTGTACGAGCGAAGCACAGCGTCAGCAGCGGCATTTGAGTCGTATTTGAATTGCTA
CGATGAGATGGACATGCCTCCGCAGCTACAGCCTGTCTCTCCGTCGCTGGATGGACGAACTCCATCGTCGATAGCATCGCCGGCATCTTCGGTGGCATCC
TCAACTGGTAGTCGGCGACAAAAGAGTAGTGTTGGCGGTGAACACTACCAAACTTTCGATGAAGATGCTTTCGCGTCGACAGAAGCGCATTGCTCGTTAG
AGTTGTTGTCAGCTGGAGCTGAGCAAGTGGGTTGTTTGCCAACACCGTTGCCGACTACACACCTTCAGTCTCCTGTCCCGCCGATGATGAGCCCATCCCC
TCCGTCCTCGGTTCGAAGTAACTACAGCAGCAGCTCTCTTAACAGCGCCGAAGAAGCCCTACTATCCGACACTGTGCTGACGCTGGCAACCCCAGACAAG
CCTAATGCAGACTCCAAGACTCCACAGCCGTCCTCGGTTCGAAGCCATCACAGCAGCAGCTCTCTCGACTGCGCCGAGGAGGCCTTGCTGTCCAACACCG
TACTGAAGCTACCAACTCCAGACAAGCCTAGCGCAGAGCCCAAGTCTTCACAGCCGTCGCCAGCTTCGGCTACGGATAATGCTGTCGCCAAACACACGCA
GCCTGCTACCAGTCACCCTGAAAACCCGATCGTCAGCCGAACCAACACGATGTGCAGCAGCAGTTCCGAGAACTTCGACTGCAGCGACATCGACGACATG
CTCGAGTACTTCGAAGGCGTGACGCTGCCTATCTAATCGTGCCAACTACTAATTTGAAAATCAACAACTTCACTTCAACTTGCCTAATGTATGCTACTTC
ACAGGTTCAAAATGCCATACAGTAGGTTTTCAATCGTCCACGCATTTCCGACGAAAATGCTAAGCCGATTGTCCGCATTGCGCGGCCGCACGGCTGCAGG
TGCTCGACGGTTTGCGAGTATTTCAGATGCAACTGGCGCTGGGGAAGACAAGGTCGGCGTATACGAGCTGGACACCATCTATGCGCTGTCCTCTGCGCCT
GGGAAAGCGGGTGTGGCAGTCATCCGAATCTCCGGTGATCAAGCCGATTCGTGTCTGCAGCAGCTCAGCAGCTCCACGGCGCTGCCAGAGCCTCGGATGT
GAGTGCAATTTAGTGCAAATAGGGGGGTATTATTCTGGTCCTGACTGTGGTGTGCACGATATGATGGGACAGAGCTGCGTTAAAGAAACTCTACCACCCC
AAAACCAAGGAGCATCTGGACGACGCATTGGTGCTGAGGTTTCCACACCCGAAGAGGTGACAATGATGATTGCAACCTGGTTGTTTAGTGGGAGCAGTGG
GGACTGATGCGGGGATTAATGTATTGGATAGTTTTACGGGGGAA