Description :
From Genome Similarity Track
Location :
contig_86:125511- 130955
Transcript NameFunction/comments
g12374.t1hypothetical protein
g12375.t1hypothetical protein
g12376.t1hypothetical protein

Sequence
5444 bases(100 bases per row)
TTGGTTCGTCAGGACTCACATTATGCAATGTTGTGACTGTTAACTGTATCACTCTCGACTGTGGCTCGACATTTAGTCGACGTCCGCATTGGATCACTTA
GACGGTGTCTACGTCTTTGGCAAGAAACTACGCGTGGACTACTCGAAGCACACGAGCGTGTCGATGCCGCACGCAGACGCGGATCGCTTTGAGATCGAAA
ATACGCTCGATTTCTCGGGGTCACCACTTCACCGCTACCGTCGCCGCAGCCCGCAAGAAGCGGTCTCTCCCTGTCCGCTCCTTCACATCTCAGGCATTCC
GATGGAGCTGCAGCGCAACGAAAACGCTCTTGCGGGTCTTTTCGCGCAGTACGGCTTCGTCAAGAATTTTCACTACTTGCAGAACAACCCCAAGATGGCG
CTGATTGAGATGGGCTGCATGGATGAGGCTATCATGGCACTTATTCGGCTTGACAACATGGCCTACCCGGACTCGCACATGCGCGTATCCTTTTCCAAAG
CGTACCAGTTTTCTGCCGGTGGTGACGTCGGTCCTGGTCCTGGTCCTGGTCTGGCCCTAGTCCTATGTCCGGCCCTGGTGCTGATTCAGGTGGCTGGAAC
CCACCGATGCAGTCGCGCCCGAGAGATCGTAGCCGCGATCGCGGTAGTCGCAATCGAGAAAGAGGTCCACCTCCAGGAGGTGATCGAGACCGCTCGTTCC
GAGACCGTGGCCCGCCACCACAGCGAGGTCGTGACTACCAAACGCGTGATAACAATCGCCGCCCTCCCCCGCGATACTGATTGTACTTGCTTTTCTGAGC
CCTTGAGAGCCTCTCAGCAACCTCTGGTGTTTGGATGCCGTCTTCACGTCTCCTCAAGTGCAATCTGCCCTCGACATCTTGGCCTTCACTGAAAGGCTCG
AACTAGCTGCTTAACACTGCTTTGCTGCTTTCGTTGTCCTGGTAAACAAACACGAATGCTGCCCTTGGCACAATTTTGCTGCGTACGATCTTGATTTTCA
CTGGCACAATAAGTTGAAAACTATGGTTGGCCCCATCGCTATTATCAAAGTTTGTGAATCGGACAGGATTTACAAGTCCACCGCGCCACTTACATCTGCC
ACTACTGTTGGAATGGATGGTGCCCGATGTAAATCCTCCGCAGAATGGCCGGGACTGTCGTTCTGTCCACTGTGGGCTGCACCGGACCCGCCAATATGAC
AGACCTCGGCATTCCCCAAGCGTGATACTTCTGATACAGCAACAGATACTGCTGCAGTAGCGTGCAGCTTGCGCTTTTTCTTCTTCTCCACGCGCTGGAT
CATTTCCTTGTCCATGTGAAGCACATTCCAGCAGATTTTTTGGTGCTCCTCGCCGGGGTACTTGCGCGGTCGGATGCACACAGACCGTTGGCAGCAGGAG
CAGTAGTAGGCGGTGTTGCAGCGGAGCCCACGGAAGTAGCACACGGAGCAGCGGCCGTATCGCTTATCGCGGCCACAGCTGCCATACATGACGGGGAATC
CATCGGAGTCGATTTCGCGCTGCCCTAAAATCGCTACCGCTCCAGCTAGTCCACCAGCGTTCTTCCCCAAAGGGTCGGTGTGTGCCATTCCTTCCTGCTG
CTGCGATTGATTGTGTGCATTGTGCGGATTCTTGGCGGCCGCTTGCAAGTCACGCAAATGATGCCCTTCAAACATCCACAGAGCATTCATCGGGTCCTTC
ACCCCATTCAGTGCCGAGTGCTCTTCATCTGCGTCAGTCAGCACGTCCATGCCTGGCGTCGTTGCCACTGGCATAACGGCAGTGGAGGACGAGGTCATTG
TCACTGGAGCTGGCGTCGTTGGCAGCATCTCACCCAGCATCGGCGGAGCTGGAGATGAAGTTACTGCTTGCGGGGTCGACAATAAAGCAGCAGATAAACT
CAATTCAGTGGCTGCGACCACCGCTTCGACGTCTCGAGCCGCCTGCTGTCCTGCTTCTAAAGTGCAGAATGAAAAGTGTCAACTGGTGAACTGTTGGGCC
ACGTCTGCAGCGGCGTCTGACCTTCGTAGTACCGCAGTTTGGCCAGATGAAACATCTTCTCCATGCGCTGCGGGTCCAGTTTGTACGCCTGCGACCAGGA
AGACGTCGATTTTTAGGAGACAACGCGGCAGCGAGAGAAAGGATAAAAGACTCACGCTCTCGACGAGCTTGGAGAGCTCCTCGTCGTCCATGCTCTTGAG
GAACTTGCCCAGCGACGCCCCTGCCCCCATGGTTTACGTGGTGCCAAAAGCTTCCTGAATGGAACCTACAGATTTCTGTGATTGGTGAACTGTCTGGAAT
TTATATTCTACACGCGAGTTTATTTATAGGAAAGTTCTTACATTTCTACTGCGATTATTGCCATAACGTTAGGGAATTTCTTCCTAGTGCACGGAGTGGG
GTGACGCTGCCCGCCGGAACGGCCACCTCCGCTTTCAAGCCGCAGGCTATCTCGCCTCGTGGCGCTCTATGGCCGCAGTGGGTTGACAACCTGCGGACTT
GAGCCGTGTCGAGTCAAATAGGATGTGAAGGTGAAGGTGGACCGGCTGGGGCCGTTCGTGGTGTCGCGCGTCGCCGATTTGTGCGAGCTGGCGTCAGCGT
GCGCAAGGCGCTGGCTTCAGTCCGAAAGCAATAGTCCGACCGTTGGCGCAGTAATTAACGACCAAGCGCGCCGTGCCCCTACGGCTGGCGTCTCGGTATT
CGCCAGCGATATAAAAAACGAGAGATACACACGCGCTATCGGCGGCCGACACCTCGTTCCGTCTGCCGATATCCACCAGGCCCGGGGTTGTACCCAGCAC
GACAACGTGCAGAAATCAATTGGAGAGGCGAGAAGGACATACTGTATGCCCAGCAGCGTAGGGGTCGTGGGCGCGTGCAAGACGAGCTTCGTGCTCGCGC
TCGGGGCCAAGGAGGCCGTCGCCTCCGTGACAAACGCGTACCTATGGCCGCGGCCCGGCGGAAACGGGCGCAAAACGATGGTGCACATCTTGCGCGGTCG
AGAGGAGGTCCCGGACGACGACGACGACGGCGTCTTCGTGCTGCTCTTTGACCTCACGCGGCGCGAGTCGCTGGCTGCAGTCATTGCACAATGGGCCCAC
TTGTCGGACGCTCCTGGCAGGCGGTTGCTGCTTGTGGGCACGCATGCGGATTGCACGAGCCAGCGCGAAGTCTCCGCGGCGGAGGTGCGCGAGATTTCAG
GCGAGTTTCACGCCTACGAGGAGGTCTGCTGCCATTCTGGGGACGAAGGCATTCTCCGTGTACAGCTTCTGCTGGCGCAGTGGACGAGCGCCGGACCGGA
CGTGATGGCGAGCGATATCCCACTAGCACGAGCCTCAATCTGCGGATACCCGAGACCTGTTGTGACAATGATGTCCAGCACGTCACACAGTTTGCCGGCG
TCACCGGCAGGTCAGCAGAGACCTCGGATGCGTGCAGATGTATGGCTATACGACCCAGCAGAGCAAGCGTCTTCGAGCGCCGTGACGACGTCGGTGGGCG
GTGACGTGAAGCTCCGAACGATTTCCAAGGCGATCTACGACATTCGCGGGGCGGTTGCGGAAAAAAGCAGGTCGTTGGCGAAATACCGTGATCGGCAAAT
GAGCCACTGGCTTACGCGCAGCCGGTACTTTGGCCCAACGGAGAGCAGTCGGCACAAGCGGTGGCAGGAGGAACAAAAGAAGCGCCAGCAGCAGCAGCAA
CAACAGACTCATGGGCACCACCACTATCATGCTGGCCACCTTCGATGCCAGTCAAGTGCCCTTGATGGTTTGCAACAGCAACGCGTGCGAAGCGTAAGCC
ACCCTGAAAAGGTCCAACCACCGAGCAGAAAGCCCACCACGCGACACAACACTGCACATTTGTCCAGCTCCAGCTCGAGCGAAAATGAGGAGAGCCCTGG
GACTCCGTTGGAGCGGAAATCCTTCATGCAACCTACAGAATTGGTCAAGCAACGACAGCGACAGCTGGAGGCAGATGCTGTACGACAACACAGGAAGCAG
GTTGCTCAACGCGCAATGCGGATGCAGAGGCGCGCAGCCTCTAACGACCTGTACGAGCGAAGCACAGCGTCAGCAGCGGCATTTGAGTCGTATTTGAATT
GCTACGATGAGATGGACATGCCTCCGCAGCTACAGCCTGTCTCTCCGTCGCTGGATGGACGAACTCCATCGTCGATACCATCGCCGGCATCTTCGGTGGC
ATCCTCAACTGGTAGTCGGCGACAAAAGAGTAGTGTTGGCGGTGAACACTACCAAACTTTCGATGAAGATGCTTTCGCGTCGACAGAAGCGCATTGCTCG
TTAGAGTTGTTGTCAGCTGGAGCTGAGCAAGTGGGTTGTTTGCCAACACCGTTGCCGACTACACACCTTCAGTCTCCTGTCCCGCCGATGATGAGCCCAT
CCCCTCCGTCCTCGGTTCGAAGTAACTACAGCAGCAGCTCTCTTAACAGCGCCGAAGAAGCCCTACTATCCGACACTGTGCTGACGCTGGCAACCCCAGA
CAAGCCTAATGCAGACTCCAAGACTCCACAGCCGTCCTCGGTTCGAAGCCATCACAGCAGCAGCTCTCTCGACTGCGCCGAGGAGGCCTTGCTGTCCAAC
ACCGTACTGAAGCTACCAACTCCAGACAAGCCTAGCGCAGAGCCCAAGTCTTCACAGCCGTCGCCAGCTTCGGCTACGGATAATGCTGTCGCCAAACACA
CGCAGCCTGCTACCAGTCACCCTGAAAACCCGATCGTCAGCCGAACCAACACGATGTGCAGCAGCAGTTCCGAGAACTTCGACTGCAGCGACATCGACGA
CATGCTCGAGTACTTCGAAGGCGTGACGCTGCCTATCTAATCGTGCCAACTACTAATTTGAAAATCAACAACTTCACTTCAACTTGCCTAATGTATGCTA
CTTCACAGGTTCAAAATGCCATACAGTAGGTTTTCAATCGTCCACGCATTTCCGACGAAAATGCTAAGCCGATTGTCCGCATTGCGCGGCCGCACGGCTG
CAGGTGCTCGACGGTTTGCGAGTATTTCAGATGCAACTGGCGCTGGGGAAGACAAGGTCGGCGTATACGAGCTGGACACCATCTATGCGCTGTCCTCTGC
GCCTGGGAAAGCGGGTGTGGCAGTCATCCGAATCTCCGGTGATCAAGCCGATTCGTGTCTGCAGCAGCTCAGCAGCTCCACGGCGCTGCCAGAGCCTCGG
ATGTGAGTGCAATTTAGTGCAAATAGGGGGGTATTATTCTGGTCCTGACTGTGGTGTGCACGATATGATGGGACAGAGCTGCGTTAAAGAAACTCTACCA
CCCCAAAACCAAGGAGCATCTGGACGACGCATTGGTGCTGAGGTTTCCACACCCGAAGAGGTGACAATGATGATTGCAACCTGGTTGTTTAGTGGGAGCA
GTGGGGACTGATGCGGGGATTAATGTATTGGATAGTTTTACGGG