Description :
From Genome Similarity Track
Location :
Scaffold_89:125503- 131358
Sequence
5855 bases(100 bases per row)
CAACGCCGCTACGGATTCTTCCCTTGACTCAACATTGGCATCCGCTTTGATTTCAACAGTCGGTACTTGGTCCATCTCCTTCCCATCCTGGTTTCCCATC
TCTGGGCCATCTGCCGAGTCGTCGTTCGCAATATTGAATGCGTGGGCCGCCGACATATTGGGTTGTTGACTTTTGTTCCGCTCCTCGTTCTGCCGCTGTC
TTGACATTTCGGAATCCGCACCAATCTTGCAATGAATACTCGGTGCCGTACTCAACACCTTCTGCGCGATGCCTGTATCCTCTGGATCAACCACTGATGG
CCCGTTCGCAGATTTGGTGACACACAAGGCCGGGGCAGCTTCGTCAAAACGGGTGACTCCATTCAATCCAGTGCCGTTGCTTCTCGCTTCCGTGGTCACC
CCTGACTGGACACTAACACTCGTTGGCGTATGTACCACGTTTACCGGCCTCAGTAGTTCGTGTGTACGCACTACCGAGGCTTCGTTCGCGTTATTGCTTC
CGCCATGGGTTGTCGTGTACGTGTCCAAAGGTTCTGCGGAAGGCTGACCGTCGGTCGAATCCCCGGCTGTCACCCCAGACGCCAGACAGGCTTCCACTCG
TTCACGTTCTTCCAGGATCAGTGCCCAGCGCTCTGCACATGTCAGACGATCTCTAGAATCCACTAGCGAGTCTTCTAGAGGTCGTGCTAGCACCCCACCG
GGTTCTGGGTAGTATGGTCGATCAACTGCTGAAGGCTGAGTTGCAAGCCATTGTTCGTAGATTTCGCATTCACGCTGAAAGAGCTTGCGGTCTCTACAAC
CTTCGTAGGCTAACACTTGCCAGTATTGGTACTTCTTGGACTCCAGACGCACATAGCCGTCACCTCGTGGCAAATCCCCATCTGGAATCCACATCGCGAT
CGAGTCGTGTGCTGGTAGGTACACAGTTCGATCGGACACGTTGGTCAATCGAATGCTCTGAGGCCGTCCACGTCGAAACCTCGTCACTGACGGGATTAGC
TTGTTCGTTCGACGAACCCACAGTACGTGTTCTTCCAGCCCGACTTGACGCTTCGCTAGTCGATATTCTCGCCACTCGTGCGCTTGAATGTCCAAACGCT
CGGGTGTTAACATGGGAGCCGTATTCTTCGCTGTCGATCATGTTCTTGGTCTTTATCAGCGGGATTTGGACTTCGTGCGGTAATTGCGCCGCGCCGTGCA
ACAGGTCCAACCGGATCCCAGCTGGGATCATAAAGTCGGTCCCGAGTACCACGTCGACGCCTGCACTATGCGCCATTACCCACATCTCAAACTCGTACAC
CATCTCCCATCCTAGCGTAATCTTGACGCACGCTCGTCGCGTCGTAGACACCTTGCCTTCCTTGATTCCTTGAATGTCAATGCGGCGTCCGTGATCAGGT
ATATCTCGGAGTCGCAACTTCTTGGCAAAGGCGTCAGTGATCACACTAACGCTCGCTCCTGTGTCGAGGAGGATCCTCGTTCGCTGGTCGTTCACAGCGC
CTTGCACCAGAGCTCTCATTCTGATCCGTCGGTCGAATTTCTTGGCCGACCACCACCCCTGTCTCTCGCCAGGGTTCAACTTCATCATCTTGGAGTGACC
CTTGGGCTCGTCTCGCGCTGCACTCGAAACCAAGCCGAACGAACCCTCGCTGGTGCCCTCATCAGCATCAGCACACTCCACGCTCTCTCCAACACCTCCA
CCGAGGATTCTACTCCTCTCCTTTTCTTTTTCCGTCGTGTTCACACTTGTTACGTAATTATCAGGCCATTCACTCTGCCCCATGAAAGCAAAGATACACT
CTGCTTCCATTGAAGGCTCGGTTAACTATGGCAGCCCGATATGGACCAACCCAGTTGTAGTTGGCGGGCTGCCTAGTTTAAATGACGTTCTTGAACGACG
GCCTTGAGCTCTGGCGGGAGTTTCTCCTTCGTGCCTTTAGTGCGCACGAATTTGGCAAGGTCTTGGAAGTTGCGGAAAAGTTCGCATTGTCCAGCATCGT
GGAGCTGCTTGCAGAACTTGCATCGCTTGTTACAGTAGTGGGCGGAGTGACTCATGCCACCGCACACCGCGCATGGTCCGTAATGTGGGCGTCGGTTGTC
GCGGTTGAAGTCACGTCGACCGCGTTGGTCCTGATTGAACCCACGGTCACCACTTCGGCGATCTTGATTGAAGCCATTCTCGCGATCAGGCGTGTTTCCA
CGCGGTTGACGGTTGTCTGAACGTGCGTAGGTGCCTTCAGCAGCTGCACGGCGCTCATTTTCGTTAGCCGCGGCGAGGTATCGGTCATTTTCATCCAATG
AGAAATCACCATCCGTATTATCGGGCTGAAAGTCGTTGTACTCGTCTTGGACATCGTTGTAAGCGTTCGGATCTTCGTTCGAATATTCGGTGCCTCCCTG
ATCAGATTCACGACCTTCTAATTCAGCTAGTAGGTCATCCACCGTGGCTTCAATAAGCGTCACTCTTGGTTTGTTGCGGTTGTCATCGCGGCGACGGTCA
TAACGCCGGTTGTTGCGGGCGTACCCATCGTCGCGTCGCGTATCACGACTCTTAGAGTATCGGTACTCACTGTCACGCTTGGCCATTCTCTCCTTGCCCT
TGAGAACATCTTCGATGATCTTTTCGAGCTCGTGAATGTCGGCGACTCGAGCGTGGTAGAGACTCTCCGCTAGCTTGTCATCGTCGCATGTTGCCAGGAA
CTGCTGTACGTGTTCTTTCGCGTCGCGACCACTCTTCTTAAAGTGTAGACGGGCGGTCCGAGCGTAGCCGTTCAGTCTGTTTATGTAGTCGCACAGATGT
TCATTGCGTTCCCGCTTGGCGGAGTAGTAACGCGACAGTGCCGTCTGCGTGAACTGCGAGCAGTAGTAGCGGATGAACGCATCGCTCAGCAGCTTCCACT
TGCGCTTCGTCTTCTTCGGAAGTTGACGGAACCAATGAATGGCTCCGTCCCGAAGACTTAGCTCAAATGGAATGCACCATTTATCGGCATCTGTGTGGGT
TCCAGTCATTTCATAGACGAACCCACGGAGCCACTGCATACAGTTCTCGCTCTTGTTGCAAGAGCCTGAGAACGGCGTGATGCGATCCAGCGGTCGGTGC
GAGGCCATTTCAATCCTCGGTGTTGGGTTCACGTCGTTCAGCGTCGCTAGCTCATTCATCTGACGCATCAACTCGAGTTGAGGATCTTCCTCGTCGAATG
TACGCACCAAAATGTCATCGTCACTGGACGAACCATCGCTGTCGACTTGACGACGTCCGGCACCACCTTTGGGAGCTCGCGCACCGCCTCGGCGATCGAA
CGAACCCTCGTTAATTGCGTAAATACGTTGCATACGGCTCTCCGAACGTAACGTAACCATGTGCGAGTCTTGAAAATACGGTGAAGCTTCGGTCGTGCCA
AAGGCACCACGCTCAGCTCCACGCTTGGTCGGAGGAGTACGAACGAGTCGTTGGGGCGTCGGCGGCAGTGGAATCTTAGACGGATCTTCATCTTGAATCA
TCGGTCGACTCACAGGCTGCATTCCGGCATTGATGCCAACAGCGCCAAACGTCTTCCGAAGCTTCTTCTTCCATTTCTGGAGAGCAGCTCCGGCTTCATG
TGGACTCCAATCCTGGAGCGACATCGTCGATGGGTACGTCTCGTTCTCGAACCCCAGCGACAACAGTAGCGAAACTGAATCCTCGGCAACTTGGTTAGTC
GAAACCGAGTTGACTGGGTATTGAAGTTCCTGCGCAAGCGCAGGCCAGTCGGCCTTTTTCTTGGGGATGGGCTTGAACAGCTGCATCCACTCATCATTCT
GCATCAGCGCTTGTACGCGGTCGAAAACGCGCTTGGCGGCTGGTGTATCACCGTTGATAGGTGGGCGAGGTGCCTTCAGCAGTGCTGAATGCTTTGCACT
TGCCACCGAAGGTTTAGAACCCTCGGTCCCATCGTCATAATCATCGTAGGCTGGTTCTGGTCCCGCAACATCATCGAGCTCGTCGGCGAGGTTCCTCGAA
AGGGACCAGGTCGCCCCGCTCAGCCCCGATGATAGCGTGGCCGTCTCCGGCGTCGCTGCGCCTGGCTCTGGAGCCGGCGTCTTGTCTTCGTAATCTTCAT
AATCGTGGGCGTCAGGACCGATGTCCGCTTCGTCGTCGAAGCTCACTGAAAGCTCGGTGGCGGCTGCAAAGCGCGCAGCCGGGCTTGAACTCTCGTTGCG
AGCCCCGCCAGACTTGGCAGGCGTAACTGGTACCGTCGGTTGTCCTTTCGCCATGTTTCTTGTCTTTTTCTTGTTCTTCTTCTCTTGGTAGCTCGTAAAC
GGGAAGGCCATACAAACAGTTCACAATGGTCACAATCTGTTCCCGGGTTGCGGCACCAGTTGTGGTGTTGGAAATCTCACGTGAACTCTAGCTACAGATG
TAGTTAGGATGTTCCCACAACAATACGTCTACTAGGATAGTAAACGATCGTTCGGGCGGACCTGAAGACGCCAGTTCTGCCCTTGCACTGGGACAAACTG
GACCTTGTAAACTACTTATATAGGCCAACCCGTAAAAATACGCTTCTAGTACGAGCAAAACTAGCAGGTGTTTTATGGATCCTCGTGGTCCCAACAGCGG
AAGGGTACCAGGCACGGGTAAGCCTTTTACGAGGTCACCGAGTGTTCAACACTCGGCTGGAAGAATAAAGGGATGCAATTCAAGCACTCCCAGTCGTGCA
AATAGGCAACAATAAGCCGTCACGTAACCCCCCCCGATAATAATCGGCCAATACACAAAGTCTCTTGGCCTTGCCGGATGAACCTTCGCTACAGAGCTTC
GAGTTCACCGACAGGCATAACACACTCAAACAAGCTTGACCTGACGCTTACCTTTGAAGCCGGACGTCGCTCTGTGTGCTTGAGTGGAAATTCTGTTCTG
TATTTAAGCTTCCCCTTTCGGGTTCTATTCCTAATAAGAAGTCCTTATCAAGTATACAAATATCAAGGTGGAACAATGATTCCGTTATGGATCTTCTTGC
ATGCCAAAGCGTCGTCTGCACTGTCGCATGAGCATCTTTTAACCGGTCCGCGCCCTGTCCCCAGACGAAGGAACGTGTCTTCCAAAAGGTCGCTGAGTAT
TCCCGCAGACTCATCCCAACCGCCACTGAGGGTTCGTACCGTAGATGGTCCGCTGAATGCGAATCCCGGCCCAGTCCATTATTAATAATAAGGACAGCCT
GGATTCAGTGACATAGGGCCGTATCCGATATTTGTTGAAAACTCGGAGGTGACGCCGTCAAGTCCCTTGCACCTTGGCGTCTCCGTACATCACCCGACCG
AGGAGTCGTCGCTTGAACAACTTGGGCGGTGTCACGTCTTTGTCGACGGGTGATAATCCGCAACCACGGAGAAATCCCTACACCACACTTCAACCCCCAA
GTCTGCCCGTCGGTCGCTGTTCCGCCCGAAGGCATGGAAGCAAGCGGTCCAGAAGAAGCGCCAGAAGCCTCGCCTTCGCTCTCCTGCCTATTCACCCCTA
CACTTCGGTGCCGCGTCGTGGTGGCGCACCGTCGGTTGAGCCGTTGCATCACCGCGTGTTGCCTGGTGCTCGCCCTACGGTGCCGGCCTCGTCCACCTTG
CCGCCGTGGGTTCGTCTATGAAATGACTGGAACCCACACAGATGCCGATAAATGGTGCATTCCATTTGAGCTAAGTCTCCGGGACGGAGCCATTCATTGG
TTCCGTCAACTTCCGAAGAAGACGAAGCGCAAGTGGAAGCTGCTGAGCGATGCGTTCATCCGCTACTACTGCTCGCAGTTCACGCAGACGGCACTGTCGC
GTTACTACTCCGCCAAGCGGGAACGCAATGAACATCTGTGCGACTACATAAACAG