Description :
From Genome Similarity Track
Location :
Scaffold_238:12550- 14363
Transcript NameFunction/comments
Phymu_g7319Proton-dependent Oligopeptide Transporter (POT) Family

Sequence
1813 bases(100 bases per row)
CATTTCCAATCTCGCCCTCGTCTGCAAACATGTCCAAGGTGCAATCACCGGCGCTCACGCCGCAATTCTCGCCGTCCGTGACCGGCTATATCAACACGAA
GCTCTGGGACGAACGGCCGGTTCGGTATGCTGCCAACGTGTTGAAACACGTGtgcatcttcctcctcatcctcACGGCATGCGAGGAAGTCACGAGTTTT
GCTATCGGCCAGTCGCTCAAGAACTTCTTCCAGAAACTGGGCTGGTCCAACAAAGGTTCCACCTCCATGAAGCTCACGTACGACTCGTTCAGCCAGTTCA
TGTGCATCGTGGCCGGATACATCGCTGATGAGCGTCTCGGCAAgttcaagacgctgctgtcagCCGCTACGTTGGACTCTTTCggcctgctcttcctcgt
cgtcgcggCGCTGCCAGCCGTCGTGAACAACCACCTAGGAGTGAGCAAGGCCATCTTCAATATCGGCCTCTTCCTGGGGGTTGCAGTCTCTCAGATCTGT
CTGCGATCCCTCGTGATTTCATACGGAGGCGACCAGTTCTCTCCTGCCGCTCCACCGTcggagaaggcgctgttCTTCAGTATCCAGTACTGGGTGGCTA
ACATCGGAGCTTTCATCGGCTATGCGGTCTTCCCTTCCGTGTCGATCCATGGCTTTGGAGCGATCCCTGCTGAATACGGATACGTCAGTGTCTACCTCGT
GGGTTTTGCTATGCTCGTGATCttcgttgcgctgctgtggtcCACTCGCAAACGCTACGTGAACGTCCCTCCTACTAAAGAATCCATCGCGCTAGTGCTT
AAGATCGTGATGAaccacgccaagaagaacttcaGCGCTCAGATGGTTGTGCTAGGTACGATTCTCTACATCGCCGCCTTCCTGCTCAACATCCTCGCGT
CAATTCTATCGGACCATGGAGAAACGGGACACAACATCTCGTACGCTTGCGGAGTGATGATCGTCGTCGCGACAGTCCTCTGGGTCTACTTCGGACAAAG
CTCCGAGTTCATGGAGAGCGCCAAGGACACAGTCGGTGGACGATTCGACCCGGAGCTTGTGAACGGCGTGAAGCAGGTCATCCGGATTCTGCCGTTCaac
gccttcaacgtcttctgGTGGGTCTGTCAGAACCAGCGCGGCAACAACCAGTCGATCGTCCAGCAGACCGACACGCGCCTTGGCAGCGGCCCTTTGTCGT
CTCAAATGCCCGGCCCCACTGTTCAGATGTTTAACCCCATTGGAGTGCTCATTTTCGTCCCTCTAATGGAGAAGGTGGTCTACCCTCTGTACGAGAAACA
CGCAGGGAAGCCCGCGAGTCGTTATggcaaagtgctggctgGATACTGCACGGCTGTTGTGGCTATGATCTGGACTGGATGCTACGAGATCATCCGTCGT
AGTACGTCCCCGCTGACGTACGTCGACTCGGACGGTGTGGCGCAGTTCATGATCAACGATGACGGGAAGCAGGTGATGAACGACATCCCGTGGTGGACGG
CCATCCCTCAGTATCTGCTGGTTGCTCTGGCCGGAGTGATGATCGCCATCCCTTCGTACGACATCAACTACTCGGAAGTCCCTCAGAGCATGCGCAGTAC
GTCCATTGCTCTCGGGTTCTTCGTCAACTCGATGGGTAGTACGCTGCTCTCCATTAttgtgctgctcttcggcaAGTACATCCCGGCCGACCTCAACAAC
GGCCACATCGAGTACATGTTCTTCACGCTGGCTGCAATTATGGTGGTCAACATCTTCTTCTACGTGGTGGTGATGAACAGGATGCAGCTGGGGATGATCC
CTCGCGTCAAGAA