Description :
From Genome Similarity Track
Location :
scaffold_1664:1255- 3259
Sequence
2004 bases(100 bases per row)
AACGGGATGAACCCTGTTGATGCGTGTATCGCATTGTTGAGTGCAAACTCAACCATAGGCAGCTGGTCCGACCAGGACAGAGGTGCCTCCGCACAGACAC
TGCGAAGCGTGTCTTCGAGAACGAGATTTACGCGTTTTGTCTGGCCATCCGTTTGCGGATGGTCTGCTGTTAACATTGTTAGCTTCGTTCCAAGGATTTG
GAATAGAGTATTCTAGAACGCTCCTGTGAACGGATCTCGATCAGAGACTATGGTCTCTGGAAGACCATGATGGCAGACGCGAAGTCGAGGAAGAGTTGTG
CGGCTTGCTTCCCTGTGACGTTGTCACGGACCGGAGCAAGACGAACCAGCTTGCTCAATCGGCACACAAACACCAAAATACCGGTGTTGTCCCTTCCATC
GGCTGGAAGGACGAAGACACAGTCGAGAGTCATTGACTTCCAGCAATCTGCTGGAACGGGTAGGCTCTGGAGCGGAGCCGAGGTGTTGCCTGCTGGCTTT
ACCCACTGACATGTTTCACATGTCTTCACGTATTTGACGACCCATGGGACCACCAGAATATCTGAGAGACCGAGTGGTAGGTCTTCTCTCGGCCCAGGTT
GTCACTAGACGGCGCGTCATGCGCCTCTAGAAGTATGTCATACTTCAGATCCTCGTCGGTCGAAACGACGATACGAGGAGGATCTCGTGGCTCTACTCGA
TAGTGGAGTAGGCCGTTGGTGCGCTCGTATCGATGGAGCTGTGGCCGCTGTCTTGAGAATTTGCTGATTGGATTACTAGCCTTTCAGGACGGTTCTCGAG
TGCGGGTGAAGTGTCAATAGTCATTATGTAACGGGGTTACATTAGGGTGACCCAATGATTGGGTACACCCGCATGAAGTGGACAACTTCACGTATCCACT
TAAGGGATACTTCGGATCGGTGGTGTACATCACACCACTGACACCAGCCAGGACGGCTGAATGAGGTTTGGCCAAGTTTATATAGATCAAACTATAGTTA
ATTACAAATTTGTATTACAGGCCGAATTAAGAATTAAGGTTTAACTATAAATGTATTCAGTCTTAAATCTACCCTATTCTAGCTAAGTTCAGCTAATTAG
TCCCTAAGACCGGGACTCGTGCACTGTATTCACTTGGAGTTTGTATACTCCTGATAGCACGCTTCCTCTAAGCAAGGTGCTCGTGTGACCCCGTCACACA
TTATTTCGTGAGTGACTTATGTACCCATATCTCGAATAGAGATATGGCATCCTTTAATGTAACCCCGTTACAGTTAGACAATTCATATAATGACACCACG
AATTCTTACCGGCTCTGTTTTTGATATTTGGGGCAGATTCGGAAAACGAAACATTCTCCTCCCAATCCTTAGCCTCTTTGTGGTCAGAAAAGCTCTCATG
GCTGCTGTCATCATCGTCGTCAAAGCCAAGAGTTGCATACAGGCCTTTCTTTTTCGTTTCGCAGAAAGGTCAACCAGGCGGCCACTCTCTTGAGAAATTT
CTGAAATGAAAGGCTCACAAAGTGTTCGTACCTAAACAAAAGGTATGTTATAGTACAATTTCGTGCCTAAAGTGGTTGCAGAAATTTAATAATTTAAATT
ACGCGTTTAATTTTTGAAACCTTGATAAAGCAACCATACAATCACTAAAGCGACCATACATGTCGCATTTTATGGTTGCGGTAACAAGCACTATTTTTTC
TGTCGCAATGGTCTAACTGTTGAGACTTGCTCTTGTCCTGGTCCTGATAGTACCTGACTCAGAAGTCGTTCAAGACTAGATCAATATCACTCTTGTCAAA
TTCCCGTCGAGCATGTTATGGCGACATTCCTTTTAAAGTATAACGAGCTGTGGAGGGAGGCCATGGACGCGTCCCCATATCTGAGTGCTGGTCGATATGG
CAAGCCTATGGAATACTCATCACACATGAAGCTCCAGAGACCTGATTCTGAAGATTATGCACATTGCCTTGTTACCGATTGGTTGACGAAGAATGACGTA
TTAC