Description :
From Genome Similarity Track
Location :
Scaffold_140:125488- 131882
Sequence
6394 bases(100 bases per row)
CGTGTGTTGCTGCAAAGGTCGCGTCATCTCGAGTCCATGCTGTAGAGAGTTCAGCTCAGGTGCCAAGGTGCCAGCGCCTTAGCACAGTTACTCCGGTAAA
GCTGCTGAATGACACGTGTTTTAAGTGGGGATTTCATTGTCCACTGGAAAAAGCGCTTCAGACTGCTTTCGGACGCCCCAAACGTCTAAAACCAAAGTGA
TAACTTATTGCAGTAAACACTTCAACGAGTTATCATAAATTCAGAGTTTCGCACTCGACCTAAAGAAAAACCCTTACTTCTTATGTGATTCATCAGTAAA
AACTCGCGCTGACTTCAAGAGCAACAAGAAGCGTGGCCTCGAGTCGAAGGATGCTTGTCTTGGGAAGCGATAACCTGTCTTCACCTGCGCTTAGTACAAC
ATGTTCCCCCTTTTGAAAACCAATCGAGATGAGTACTCCTGTGAAGCAAACATTAGCGTCACAAGGTTTCAGTATTTGATGTGATTTGTTGCGGTTTAGT
CGGCTAACTACACTCAATGCTGCACGGACAGCGCGTCGCAATGACACAGTTCCGCGGTAGCAGCCCCATCGATGGACAGTGTCTCGATGACATTACCGAG
TTCCTACGACAAAGATATGTAGAGTATTCAATATGAAACAGCTAGAGGATTCCGCACAGAGCTCAAAAGCAGTATTTTTTAAAGTAAATTTTCTGAAACA
ATTTATTGGTGTGACCAAGTTAAATCCAGATAATTCGGTTTAAGCACAGACAAATATCAAAAGGACTTTAAGAAGTGATGAGATGGCAGACGCAGATAAT
TTGGAGCCCTCCAATACGTATTGGCGTGTGTGGCGTTATTTAACCCAAAACGCAACTAGCCAAGTTACCAATACTGTTTCGAAATTGGGTCTTAGTCGAC
TTGCCCATTAGGGTCGTTCTTAACCACGCCATGCCCACAGAAAGCTGTGATCTGATTGAATAAACACATGCTAGGGCTAGAGTTTAAAGAAAGTAAGATG
GCAGGAAGTGCTACGGATGACATCTGCAAGTTCCAGGTGCCATGTGACTTAATCATAATTTTTTATTTGCTCAAGAAATAGGTATCATGATGGCACAATA
GCAGGGAAATTCTATGCTTAACCACGCCATGGCATGGCGTGGTTAAGGAGATTCCTTTTAAACACCTTGCATGTTAAATTCAGTCTTTGGGGTTCGACTA
GGCTACTAAAACGGGTAGGAGTCTTGGAGGATCCTCACGAAGACGTCGTCCGTCAAGGGCATCACAATTTTCGACACTGACTCTTTAGATTCAAAGTCGA
ACACGTTTAGAGCCTCCCGAGCCTCCTCTGTTAGCTGCTCCCACGAGATGAGATCCTGCGTTTCACCAGTCTTTTTCGTAAGCCGCAGTGCTTGTTGTCC
AACCCAGAAAGACACGTCGGAATCGATCTTGATGGTCGTCTTATCAGCGATATATTTTGCCTTGGGGAGTTCTCGTTGATGTAACCAGCACTGCCAGATA
GAGACACACCAAGAATGGTTGAGTACTCAGGATTCGGAGAGCCTGTCCAGACGATTGCGGAAAGCCAGAAGTGACGGTGACCAGTGTCATATCTAGTTTG
AAACTGTGGTCCTTTCGGGAGGTACCAAGCGTACATAATGGCCCATTTCCCCTTGAACCAGTCCGATCGCGAGTAGATTTGAGACCCTAAAGCAGGACTT
TTGCAGTCACCGTTGGGACGTCCAGACCACTTTAAACCTCCACTGATCGATCCGTTAGCCTGAACTGCAGGGTAAGGGTGACATCCCCGAGAAACGTGAA
GTTGTGGTTTAAACTTGACAGCAGATTTATCCGAGTCACTGGCTGCTCAAACGGCTGCACTTGATCGTGATTTATAACTGTGATGATGCTATGGACAGGC
ACCATAAGAAGAAAGACACCGAAGAACAATAGACACAGAGTCATTGTTTAAGCTGATGTGTGTTTTTTGTGGCTGGTTTGGAAATGCCAAGCCATTGGTT
GGTGTTTGTGCAAGTTGTTTATGTACTGCTGCATAGATTACTGGATGAATCGCCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTCTCCTTTTGTGCC
TCTCCGCCTTTCCCTTAACCCGGACAATTCAGGTCAAAATTAATTTTTGATTGCGGTAGCTGCAGCATTCGAAATGCTTGACATGCTGCTGCCCAGTATA
TGCTGACCGAAAAATGCATTCCGTATTTTCATTACAGTTTCAGAGCGGAAAGGATGCTCCATTGTAATGATTTCGTGCGATTGTATTTTTATCAGGGCAC
TTGCTATTCAACCCGACTGATGTGGAAGAGACAGGCTAATGGTGCCCGACAGCACCCGATCGATGCCCGACCATGCCCGACACAAAATAAGTCAGTTGAG
CAATCAAGCGTCCGTATACGTATATCCGGATGTGAAGACTTTGTGGTTAGAGCGTGCAAGTACGACCGGCATCATGTCATGAGCATGAGAAACTTTATTC
AGTAGAGCTCAGTGGGACTGGTAAGTGCAGAATCAAAATCAACTTGTTGAAAGAGTTAACTATAGACACATATATATGTATCTGTAGCGCAGATACTATA
ACTCCTTCCTACTCAGCATGCACAGACCTTGGGCACCAGCGAATACACCAAACGCTAGCAGAACATACATACCACAATTGTATGAATCTACTTGTACCCC
TAGATCGCCCATGTAGTGGTGTACTCGGTATTTCCTTGGTGCGTAGTTTGGCAGTTGCATTGCCAGCTTTTCTGCGATCGCTCGGACTCTAACGACATAG
CTCGAGCTCATTGGGTCATAGATGCACACATCATTCAGATTTAAGCTCACCATTACGCAGCACCAATGCGTGTTGCTGCAGCATATAGGGATCAGAATTT
TCTCGTTCGTCTTGCCCGCGAAAATTGTAGCGAAGGCTCTGGTATTGACAGGGCTATCTTCATTATCAATAGAATCTGCAGCGGGGCTGCCGTAGCTTTA
GCGTCAGAGGAAGACGTTCGACTCAAAGAGTCACTAATACTAAGTTCCTTATCCAAAGGACACTTACAGCCCAAGACCAGGGCTCAAAGTTAACACCTTA
ACTTTTATGCTTCAAAACCAGAAGTGTTTTATTTACTATTATTGCGGCCAAGCCGCCTAGGGGTAAATGTATCAAATGCATAACGTGTGGCTTTCAGCCA
AAGTACTGAGAGACCTTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCAACTTATGTACTGAGAGTTTGTTAACTCTCCGGGTACTTCG
TACCCCTGTGTGTTCCACACCATGTAACCCCGTTACACTCTCCCTCACTAAGATGAGAACATACCGTTCTCGAACTTTCCTCAGCGAGTCACGTCTTTGT
CAAGACGACGGAGGTCACTAGACTTCACTCTGCGTTCTGCAGCTCCACGAGCTCACAAACGCGTTCGCATCCTTGATGCCTGGCACTTCCACTCCGGCCC
ACGGCCCAACGTCTCCAGCGCGTCGCGCCGCCCCTGCCTCGTCGGTCCCAGACACCCGACTGCGCTCCGCAACTGCTCCAAGAGCATCTTCGTCTCTTTC
GGTGGCAGAGTACCACCAAGCGTATCGCCGTCGACACGGTCAACGCTCCATGAGCCGTCAACAAGAAGAGAGCAAAGCTCAAAGCTCGTCAGAGCCGCGG
GCGCCGCCCAGAGGGAACGATGTTCTGTTCTCGGAGCTCGAAGAGGGCGAAGTCGATTACGACGAGCCCATGGGTAGTGAGGATCACTCCAACCCAGCCT
CTCCGAGGTCGCACACTGGTGCCGCATCTTCCCCAGCTTCCTCTGTGAGGTCTAGCCGCTCAACGGCGCGATCTCAAACAAGAAGAGACCTGCGGACACC
GCATCTGTTTCTCGGAACGTTCGAATCCGATTCGCTCGCTGCGCGATGCGCCACCGCTATCGTCGCCGTATGACGAGGAAGACGGAACGATTAGCAGAGG
CCATAACGAATGACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCATCCACATTTGGATCATGCTCATCGAGCAAGT
TGTTTCAAAACAACTATGCGTCTATCGAGACGCTTGTGCCTGAACCTTGTTCAGCACAACACGAAGCACCTGCTTCCTTCGGGACCATGTCCCTAACACT
ACGAGGTCTCTCCACCTCCTGCTCCCGCTGCGAGCACCGCTCATACGTACGAGCTGGCTGCTGCAGCCACTGGTCAGAGCCTGAGCTCAACTACTGACCT
CATCGCTCCCCACTCTAGTGGGAGGCGCCCAGCGCTTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCAGCACATGATGTGCCCGGTCGTAAGCGTCAA
CGACGTCAGGGCAATCTTGCCGGAGGATAACCTCAAACTCCCATGAGTTCTGTGAGTGAGGGTAACCCCTCCACTTCACTAAGTACTGGGTACGACCCTG
GCGTCTACGCCACGCCACAAGGCGTTCCACGTGAAAGTGGAGCTCACCATGCTCATCGAGCAGAGCAGGAGGAGGCCTTGCCTCAGCTGGGCTCTCGCGG
GGAGAGTCAGCACTTGCCGGAACGGCGTCTGCGTCCATACGACGCCGGCGTCCACAACGCGAACGTTCACCGCCCATCGGTCGATATCGAAGAGATGATT
CACCTTGTGGATAGGTTAGAGCCACCACTGTTGACTCACAACCAGGTCTCGGACCTTGAGCGTCCAGCTGCTCGGCTGAACGTTCAGCTTGCCT