Description :
From Genome Similarity Track
Location :
Scaffold_173:125455- 129035
Transcript NameFunction/comments
Hyaar_Emoy2811878PREDICTED: E3 ubiquitin-protein ligase MIB1-like

Sequence
3580 bases(100 bases per row)
ACGCACGTAATTAAAGCAAAAGCGACGTCACATTTGTTCACTAAAGCTCAGTGCTAAAAAGAGACTTCATTCTGCGGGTAAAAGCGATCGCCAACGTGAC
CAACCAGCCGGTTACCCCTCCCCTACGCCCGACATCTTCTTCTCACTGTGTGAGCTGCTCCCACAGCTTGTCCACATCTCCACGCGAGTCAGCAGCCAGG
CTGCGGCCGTCCAGAGAGATCACTTTGCCCTCAGCATCCACAAACACGAGCATGGGGATGCCCGAGACGCCAAACTTGGAGCTCAGAGTCTGGTGGATGG
TGCGCTCTTCAAAGGGAAGGGCGAGGAACGTCATCTCGTTGTAGTACTCCTTGTACTGCGCCGCGTCCTTGTCCGACGAGACAAAGATGAGCTCAAACTC
CGGGTGCTGCTCGACCATGTCCTCGTACAAGGAGCTCAGAAAGGGCGTGAACTGACGACAGGGCGGGCACCAGTGCGCGCTGAAGTAGATGCCCACGACC
TTTTTGTCGGCGAGCGTCGCGTTCGTGTCCTGCAGACCATCTTTCGTCTGGAGCTTGGCACCGAGGAGCTCTGACCACTGCATACTTAGCGGCTGTGTAT
CTTAATTTGGAGGGGGATCCGGTACTTTGAGAGCAAGAGATTAAATGAGCCAAGAAAAAGATTAGAAGGAGACGGACAGAATAAAGAGGACAGTGAGAAT
GAGAAGTTGACGATACACACGGTACGATGGTAGTTTCTGTCATTTTTCACTCGAAATATAAAGCTGCAGCACGAAATGTCCATCACGGCCGAAATCCGAT
AGAACAATCGTGTAAAACATTTGGAACTCTTTTAAACAAGTACTACAGTAGTCTGCACGAGTACTGCAGTAGTCTATGATCGAGTGAGAGGGTGCGATGC
TACCCGCCAAATTGTCTGCATCGTTATCACAACAACCTTTGACTTTCGTCTGTGCCAAGAGAACAACTACTCGCACTTAACCACCCGGCGCGCGTCTAGT
GCTCCGCCTATTCTCGTCCACTCGTCTCGTGTGCAAGCGCCTTCGCCGCGTTCTCGCGGGCTAGCTTCTTTGTCAAGTGACGGTTCAGTGGCTTCTTGGA
TGCATCAAACTCACGCAGCACAACCGTCAAATGCGTGTGTGGGTGGTGCATGACACCCGAACGTCCTACAAATGACCCAACCACAACGACATCCAAAACA
TCAGCTCAGCTCTTTCCAATGTCTACCTCTTCTTTACTACTACTAGCCATCACAGCTACAGCTCTTTGTACGCACCTCGACCCATGATCCGCATACGCTT
GAGGTACACGCCTTTGTTCACAAAGCACTCGGCCACCAGGAGGTTTTCCGGCTCAATCTGATACTTGATATCCGCCAAATTGATCGCATTTTGCACCGTC
TTGTGAAAGATCTCGGCCTTGCGCTTGGGGGAGAACTTCATCTGCAGAAGAGCTTCAGTGGCAGACAAGCCACGAAGCTGCTGAGCCAAGTACGCGAGCT
TGCGGGGGCTCGCACGGATCGCGCGCTTTACAGTCTTAACCGTGCGTGGCTCGGAAGTAGGCGACGTGGAGTTCAGAAAAGCGGCTGTATCGTCGTCGAT
TGCACCGAGTTTAGCGTCCACACCTTCAGCAGCTGTAGACAGTGCGGCTCGGGTTATAATAGCGCTGCGAGCGACTGGACGGAGCGTCAACGCGCCCATC
TGCGAGCGCAACAAAGCTAGCATTTTGTTCGGCGTTTGCGGCCAGTAACTACGGACGGGTTTAATTAATTGTGTACAGAATTGTATCGTGTTACAGAGGG
ATAGTTACGTGTAAACAGTCGACTGATTTACGACAAAAGGTCTATAAAAAAAACCAGAGAGGTGACGGCATTTCTAGCTGGACGCTAACAAATGACTAAC
TCTTGGCTGAACAATCGGTAAATGAAAAATGTGACACATAACTAGTATAAACATGATCGGCGGCCATATGTCCTCCCTCCCTACAGGGTCACTTCGTTCT
AGATTCACTGGACCGCCTTATTCATTTGCTTTCTTCCTTTCCTTCCTTCCACGACATGCAAGTACACGAGGCAAAACCTATCACGCAAACGGCGACGTCG
TGCGCGTCTTCTTGTCCGATATCCAGATGCGCAGCTTTTCTAAGTTGTCGAAAAAGTGATCGGCGCCTTCATCTTCGTCGCTATCAAATGCACCGGCACT
CATTCGATCCACACTTGGACGACAGGCCACAGTCATTCGATCCGAGTCGTCCGGCAGCCATTCAATGTTCACCTCAATGTCAGTCCGATTAGATACCAGC
GGCATGAGATGGGACACAAACCGCTGGCGAGAAGCAGGTGGAAGTGACGGGATCTCAATACCGCGGACTGTGATCTTTACTGCGGATGTACCCATCACGA
TATCGGCAATCCACTCGCCCAAGTACTCAAACTTGTCTGGTCGTCCCTTACAAATATCGCGGCGAAGCGATAGGAGAAACTCGGGCGTGAAATGCTTGCA
CTTCTTCTGTAACTTGTACTGTACAGTGGCCTCACTCAGCGCCTGCATTTGCTCCGAGTTCTCCATGCCATGTGTGCCCATATCATAACACTCACTGCAC
AAGTTGTAATTTGAGCAGACACTGCACGTCCAGAGCGCGCCTGTGATCGGGTCCATGCCGCAGCCATCGCAAAAGGAATCCGAATGCACTAGCGTCTTCT
TACGTTTCCACTTGGAGCCAATGATTAATGCTCCTTGGCTCATTGCTGCACCCAGACGACCCATCAAAGGTTTCGCGGGTGAGAGCTTCTTGTCCGGAAG
ACTCTTGGACTGCACCGTGTCCTTGTCGTGCAAGTCGCGCTGAAACACGAGCGTCCGCGGTACGGAAGACGTCTGTATGATCTCAAGCACCTGCTCATTC
GTCGTGTGCGGCTCAATGTGCTGCCCGTTTATGCTGATCAGATAGTCTCCGACGACGACACCACCACGATGCGCCGGACTCTCCTTCTCCACACTCGAGA
CCTCGACCAGCAGTTCCTTCTCCAGCGACATGACGACACTTGTGTCAAAGCCCAGCACTGGTTCCGTAAATGTCAACGTGTACGAGTTGAACGACCTCTC
CATAGAGTCAGCCACGGATTGAGCACGCAACCCCGGCTTATCGTCGGACACGTGGACTGCACTTGCACTGGACGAGTTTCTGCCTGATGACTCACCGCTG
CTTGTCAAACTGTCCGAGCTAGCTACAACTACGGGTGCCTCGCTAACAAAGCGAGGCGGCTTGTCATGCAGTGCGACACGACGCAAACTGTGTAGCGCAC
GAGCTGATGATGGATCGGAAGCCACGCTAGGGCCCAGAAAGCGATGCGACGCAAAATCATCGTGCCCCTCGCCAAAGCCAGCAGCGCTGGCATAACCAAG
TGGAGTGCCCAGGTCAGCATCTTCCTCAGTGTCTTCACAGGCAGGTTCTTCCGCCTCGTCTTCGCTGTCGCTTGCTTCGTCATCAATATCGTGATGTACC
AGGTTCAAAGCGACCGGACGTTTCGGCGACGGAATCATCAGCTCCACTCCATGTTCCGGGGTACTCGCTTCCTCCACTGC