Description :
From Genome Similarity Track
Location :
Scaffold_396:12545- 14035
Sequence
1490 bases(100 bases per row)
CGCCCCTCCTGCTCAGGGTAGGACACGATCCGCTTCTTGGTGAGGAAGCTCGCCACCTGTGTCGCGACTCGGTCGCCGATGCGAACCAGCTCTCCTTGTT
GCCACGATTTGCACCCATCTCCACCCTGAGCGATGAACTTAGTCGTCGCAACATGCACCCACTCGTCCTGGTCGAGAGGTTGACCCATATCGTTCACCAT
CTCCACGATCTCGGGAGGCTGCTTCTTCCAGTCGACAACCACACGTAGACCTGAAATGTGAGGGTGTGATCCCGAGAGTTGTGGATACTTGGCCATATGC
TCGACGATGGCGTTGCCAAAGTCCCGTGTGCGAATGCGGACGACCGCCGTCGGATTTGGGAACGGCATCTCGTGGTTGATGATCCCCACTGTGAGGTTGG
TCGCTGCTCCATACATCTTGTCTCCGCGAATGAACCCACCATTGACAAGAGCGTAGTCGGCGTCCAGCTCGCAACAGAGAGCATCCGCCACCAAGTTCCC
CATGCTGCTCTCCCCGGCGCGGAGCGCGGTCGTCTTGGTAGACAGCGGACGCTCCAGCACGGCCAAGATTCGCCCATTGTCCCCAGCGCTGTCTTCCTCC
TCGAGCATCTGCATGTACTTGTGGATGATCTTCTGGCACGCGACTTCTGGCTGCACGTCGTGGTTCGGGAACATCGTCCAATGCGGCGAGATCGACAGCT
GCCGGTGAGGGTTCTTTGCCGATTTCTTCAAGTCAAATTGGAGCTTGGCGAGCCACTGCGCATTCTGACCAGACTTGTGGATCAAAGTGTTGCCCTCGTA
CAGAGTGAATGGCTCGTGGTCGTGGCCACCCAGCATCACATTGATCCCCTTCACTCGGCGTGCGAGCAGTCGGTCTTGCTCAATATTGAGATGCGTGAGC
GCCACAATGAAGTCGGCGCCTTGAGCTTTCAGTTGCTCAACGCACCGCTTGGATGTCTTGAACACGTCGTCAAACACGACGTCGTCGCCGGGAAAGGAGA
GCTGCGGAGTGTCCTGCGTGCACACGCCAAACAACCCCAGCTTGAGGCCATCGTTCATGTGGATGATCTCCGTGTCGACGAGTCCATCCATGAGTTTCCC
CGAGCTTGCTTCCAGCACGTTCGAGCCGAACCACTTGAATTTCGACGTCTTGATGTGCTCGCGCACCACTCCGGCGCCGAAATCGAACTCGTGGTTACCC
AGCACGACGTACTGGATGCCAAGGTGGTTCATCAGCTCAATCATGTGCGCTCCCTTGCATCGCTGCGCGAGCTCCGAGCCCGACAGGAAGTCGCCGTTGA
GCGTCACGAGCAACGTGGCGCCTGGGGGAACTGCTGCACGCTCTCGAGCCAACAGCGTCGCGAACTCGGCGATTCCGCCGCGGCCGTCCTCGTCCGGGAA
CATGTCGTACACGTCGTTGATCGAGAGCACGACGACCGAGGCAACTTGGTCTCCATCGTCGGTCTTGGTGCGCAGGATGGTCATCGTCGC