Description :
From Genome Similarity Track
Location :
scaffold_21:12543- 13682
Sequence
1139 bases(100 bases per row)
gcagtgcgtaaagacgcatgatctgtgtagatcagaAACGGCTTCGAGCAAAGCAGGTCCAccatgaacttgacaagtgcatacttcatcgcaaataaCT
TCTTGTCGTAGAGTGGGTAgctcctctccgcagccttaagctggcgagattagAACGCGATCATCCGATCTCGACCcgcggcgtctgcttgcagcagtgc
aagccgacggcaaagtccgaagcgtcacagacgacacttaaaggacgatcggggtctggcaacgacggtattggtgcatgaagcaggctgtctttggccc
tgccaaaagcctcccgatactcggtgtcccaacaccattccgtatccttaaAAAACTCGAcagtggccgtgccatttccgcatacttcgcgctatacttg
tgcaagtagttggcgaggccaaccATTTTCGAAAGTTCTTTTGGTTTTTggagccggccagtccacaatggccttgaccgtAGCGGGATCTACtcgcgtg
ttacgcagtatttggttaccggaaccaggtcaaactCACGACGCACACTTCGGTGCAGAGGTAGGACCAACGGCggttctttggagacgacgtcttgaaa
tcctTTACCAAGGATAgcacggatccaagggatccgtcaggatcaacgatccactttgtgcgttcagcactctcttggtgtcctctaggacagcttcatc
cagaagcgacgacgagttaagctcctcgttcggtcgtataatcaCCACCTCGGCtcaatcgcctgccttcaaggcaccgcaaaactcttcgaagggcaTC
TCGTAaagatcaagaagagcatccaccgcggaatagccttgagggtgacgttgccgtcttcctctcccgtcatactgttgacaagggtatatagctgtgt
gctatcgtctacagtaGATACACCCtaagtcagggtcgacgccttatgtcttgcagataacattcGGCATCGCcatctcctctctatagaagttttacgt
ctcatcgagatttGTAGGCGCAAGCATTCAGCGTGGTCCAATGTCCCCACTTCCTTCTCCATCGAAGCCTTAATGGTATTAACagcatccgacaaagagc
tgctatttccgcagtcttcgtttagtggataacgtgcca