Description :
From Genome Similarity Track
Location :
Scaffold_8:125410- 126872
Transcript NameFunction/comments
Sapdi_VS20SDRG_03286hypothetical protein

Sequence
1462 bases(100 bases per row)
CGCTTTCAAGGCGGTCTGGGTATGCTCGTGCTCGATTTCTTTTTGTATGCGCTGTTGGCCATGTACCTCGAGCAAGTCGTGCCGAAGGACTATGGCACGC
CCCAGAAGTGGTATTTTCCATTTTCACCAAGCTACTGGTGCGGCGCGGGCAGTGCGCGGGGTCCTGCCAAAGTCGGTGAAATGAAAGTCCTGGATCCGTC
CGTCAAGAACGACAACATTGAGACCGTCGGCACCGAGCTCGAGGTCCATATTTCCGTTTTGCACTGTATCAAAGTATCAGAGTATCAACGGCGCTATGGT
AGAAACAAGAGTCGAACGGCGAAGCGCTTGTGATCCAAGGCATTCGCAAGGTGTTTTCCGTGCCCGGTGGCAAGAAGATTGCGGTGAAAGGCGTCGACCT
CGTCATGTACAAGGACCAAATCACGTGTCTTCTGGGGCACAACGGCGCCGGCAAGGTTGGAGAATATTGTCTATCCAGGGTGAGGACTCACCTTGTGTAG
ACGACGCTCATCTCGATCCTCACGGGCATGATCCCGACGACCGAAGGCGACGCGTTCTTCAACGGCCACCGCCTCACGACGCAGATGAGCGAGATCCGCA
AGTCGCTCGGCATGTGTCCCCAGCACGACGTCCTCTACCCCGACTTGACAGTCCGCGAGCACTTGGTCTTTTACGGCAGCGTCAAGGGCTACACGGGGCG
CGACCTCAACGAAGCGGTCGATGGTACATTGTCCATTTCTCGAATTCGCTCTTGATAGTTTGATACTAGAAAAAATCAAGGAAGTCGGTCTCACGGAGAA
GCGCCATGTCTTTTCGACGGCGCTCTCGGGTGGTATGAAGCGCAAGCTCTCGATCGCGATCGCACTCCTCGGCGACAGCCGCCTCGTCTTCCTCGACGAA
CCGACGTCCGGCATGGACCCGTACTCGCGCCGGTCCACGTGGTATATAGTCGCATGAAAAATGAGGACGAGTTTCGCCCACGCTATGTATAGGGAACTCA
TTCTCAACAACCGGATCAACCGCGTGATCGTGCTCACGACGCACTTTATGGACGAAGCCGACATCCTCGGCGACCGCATCGCAATCATGGCCGAAGGTCA
AGTCAAGTGCTGCGGGTCGTCGCTCTTCCTCAAGAATCGGTTTGGAGCTGGTTACAACCTCACGATCGTCAAGGAGCCAACCGTGAATGGGTGCGTCATC
TGCACGTAGCCATGTCGAACGGCGACCGACACGTTTGCGTAGCGACGAGGACAAGAGCCATGCGCTCACAGCGTTTATCCAGCAGCATGTGCCCACGGCC
AAGCTCCTCTCCAACGTCGGGTCGGAGATTGGCTTTCAACTGCCGATTGACAGCTCGCCAGTCTTCCCAGAAATGTTTCGTGCGCTCGAGTCGGCCGAGA
CGCGGGCGTCGCTGCGCGTCGCGTCGTTTGGCATTTCGGTCACGACGCTCGAAGAAGTCTTC