Description :
From Genome Similarity Track
Location :
Scaffold_223:12541- 17848
Transcript NameFunction/comments
Hyaar_Emoy2812878AlNc14C40G3439

Sequence
5307 bases(100 bases per row)
CCCTCGACATTCCGATATGGCTACATCAGAATTCCCGTCATTCTGGTGCAACATTTGGACTGACGCACAACCAAACAGAACTTGGCCAGCATAAAGTTGA
ACCATGTTCGTGCGACAGCTTCCGCGCAAGTCACGCACGACGCAACCGCCGACCAGTTTACGTCAACACCTTCAACACCTTTTCCAGCAATACTTGAGCT
TCATTGTCCTTGCCGTCTAGCAGCTCTCGCTCTGCCTTGGGCAAACGACACTTGAGACGAAACTCCTTCTGGTACTGGTCTACGTACGAGATGTTAAAGC
GGAGACCGTAGGTGTTTAAATGCACCGTTGACTTCGCTTCAGTCGACTTGATGTTCATTCCTATCGGAGCTGTTTGGCGTAGTGAGACCTTTGTAGCAAA
AATGTCGCCATTATCTGGCAGCGAGAGCTCCAGATGGCGCTCAATATCAGTCCAATCGTCCTTCGACAACTTCGTGCGGGTAGAAGCCCGCATTCGGAAG
GAGATCTCATTATTCAGGATAACGTCGTAGCTACCACGCACGTGACGTCTATGGTAGATGCTGTGCAGCTCCCACTGACCATAGACGAGATGGTACTTCA
CCTCATACGAATTTCCGTCCGCATCTGCTACATGCATCACAATCAGTTTACGTGGCTCCACGTCCTCCTCCATCCACTCCTCCAGGTCGTCCATCAAATC
AGACATGCAAGGAGTCGCGCGTGAGCAGAAATTCGACCAGCGCGTTGAAAAGTCGTCGTAATTGCGAAGACGCTGCAGCTCCGGCCACTTAAGCGTCGAA
TTCTTGTAATGACTTGATCTGAGCTTAAAGCACGTTTTCCCAAATGCCACCCTAATGTCCACGGGCAACTCTGACGGGTTCTCGACTAGATACGCCATGA
CTTCAGCCGTATCGTCTTCACGAAACTCCTTGATCCACGACTCATCCTGGCTCGCAGTTTCTACTGCCTGTCCGGACTGCTGCAGGCGATACGGATACTC
TCCAATTTGCGCATTGCTTGAAGCCTCCTCGTCTTCCTGAAACGACCACAAGTGAGTGGGTCCATCCTTTGCTAAGATCTCAAAGACCCGATCCTTGGCT
ATAGCGAACGTATCAAACAACTCCGCCAGGTCGTCTACTGCACGTTCGATGCCGAATCTCGACCCCTTCAATGTCACTTTTCGGTCTGATGCACCCACAG
CGCAGCGAACGCCATAATTCTGGCGAAGCGCTTTGCAGTAGCTACCTCCTTTGCCAATGACAGCCCCAACTGGGACATAGTCGGGAATCGGTAGGTCACG
AGAATTCATACCGATACGTTAAAGCCAAGCAGAAAATTGTAGAGTGAGGCAACGGTATTCGTTCGTGTATAGTCAAACGAGATGAACCCAGCCATTGCTT
GATGGATGAAATCTATCAACTGACTGCAAAGTCAAGAACTATCATTGATATCACATTTCAGTAAAGTTGGCTGTTGTCGGCGAAAAGCCTGAAGCACATC
AAGAACTTGGCGTGACGCATCTTGCCGAAAACACCCGCGAGCTTGGAGACGCCAAATTGATAGTGCTATTCATGTCCTCTGCTGGGTAATTTACTTCACT
GGCGATTACTCGTACGAAACTTTTTCAGTTTCTTTGTAGCAGCGCGTGCTTACGGCGCTCGAAAGTAAAATCACTACGGATGAGTTGTGCTTGATAGCTG
CATACTGACTGATTCCTCAGATGACATATGCATGATCGAAAGCTTCGACATGCTGTTGACTCATTCGATGACAAATGCAATTTTTTTCGGTACTGAAGGG
TGCGCCACAGATAAAAGCCACACCGTGTTATAAACATTTCTTTTTATTTCCTTGTTGCAGGTATATGATAATCCCGATGGCGCACATGTGAGCAATACCA
TGTATCTCGGTTGGCCAGCGCCACGATTCATCAATGAAGTTTTAAAAATGCGCGGCGCAAGTGACATCTGTACACAAAGTTTGACGGGCTTTGATGTATT
ATTTGAAATTACAACTTTTGTGCATGTTGAAGTAGTCAAGGGTTCAGTTTCTACAAAACTTATTGCTCAAGGTTGTTGATAACTAGGATCATGCGTTGTT
CTGATCTCTTAAGTTCCACAAATGACTTCACCAGCACAACTTGAGCTAGCTTGTAGCTTTTCATACGTCCCCTACCACACGGAGCAACGTGTCAACATTG
AGACTCATCATGTGCACCACGTTTTTAGCACTGGACTACTGCAAAACGTACATAATTCGTGTACTCGCTATCGTAAAGGGTACCACTATCAATTGTACAA
GTGAGTGATCGCTATACCCGGTACACATGCAAGAAGAACGGGAAATGTACGCCGATCTCCTATATAGTTTTACTCAATCACATATACCCAGTTTTTGTAG
CAGTTACTATACTTATTTGCTTGCTGTAAACTAGCAGTGCACACTATAAAGCGTGCTTATAGGAACGACGAACGTCAAAATCGAGAACATTGCCAGGTTC
CTGAACACCATGTGGTTATGCGCGCGATTGCTTGCCGTTCGTACATACACAAAACCACATGAAATCCACTACCGCATCCAGTTTCTCGCCAATTTTGCTG
CATGTGAATAGTCCAGAACTGTTACCGATACAGACGTAAATTATACAGATAATATGAGAGGGTTGCGGAAATATCGACTTGATGGATGCGCGCGCACAGC
CATTTGAATGCTTGGCAAAACGCGAGATCGGGATATAGGAAGTAAAACAAAGTATCAAGTGGATGCAAGCTTCCTATTGAAACAGATGTCGAAGAACCAA
TTACCAGCAAGCGCATGCTGCGGTCATCAACCAATCTCGAGAATCACTAGACAGAAACCATCATTCCTGAATTTCATCGACAAGCCTCCAGACCTTGTCG
TCTACTGGTGCATAGGAATTGCAGATACTATAGAAAAGTGACACGCACGTTGCATGCATCTGGGATAATGGCTTTGCAGAAGGGTAACGTAAGGGACGGT
GCGATAACAGACGTAGGAGGCCTTGTTTACTTGTGACCGACCCTGATGAAGGTAACTGTATATGCATCAGGACTTGAATTCAAGTTACACTGTGCGTTGT
GCAATTCAATTTATGTGGGATATTATATGCGCGATTTGTAGAAGATACGAAAGGCACCAGCTCCTGCCTCTAGAGGGGAAAGCATCGTCGAGACGGAATG
ATCCTTCACCGTATACCTACAAGCCGGGGGCAGCGAAGTTCAAGCTGCCGAAGATCTGGGCTATGGGAAGATATATGCTGAGTGGCTGAAAAACTACCAA
CTACTTGCTTTGCATCGAGCAGTATACAATAGCTTCGTCGGCGAAAGAATAGACACGTCAACCGAAGAACAATTTCGACCCGATCAAGTTTTGTTGGTCA
TCCGCTCCAACAATTAACTCTGGGGCAGAAGATACGATCTCGAGTAGCAACTTCCACGTAGCAACACTTACGACAATTGCAAGTATACAGCAGGCGTCGC
AGAACGAATAACGTCAAGGACGGCAGTGAATGACGAGACTGCATTGGACGAGCACGCACAGCAAGTTGACGTGATCAAAATTTGTGTAAATAGTCCAATG
AGTCCAAATTTGAAAACGATGTCAGGTCTCAAAACCTTTCGTAAGTCTGTCACTCTAATTTTTCAGATAACAAGAAAAGTCGCTGCAGAAAGCGCAGTGA
CGCCACCATAGTATATGATTGAGCCCAGGCGACGACCTAGGGGCAACGACGTATCTGTAGTCTTGACAAGAAGATCAAATGTGAACTACGCTGACGAAAA
TGACGTGAACTTCAGTACCGCTGACGTTAGTGACGTGGAGCATGAGGTTGCAAATTCTGAAAATAGCTCCGAGGCAGAAGAGACAAATGGACAAAAACAA
GCGGAGAAGAGTTGTGCCAGAGGGTTAGTCAATTTTTCAGGAGACTACTGATTGTGGGCAGAATAATTGCGCAACAAAGTAAATTGATGACGTAAGCAGA
GGACGACGACCGACTTTTTTCTGGAGTGTGGACGAGGAGCATTTGTTATGTCGTGGCGTGGCAAAGTACGGTACCGGCAAGTGGAAGAAGATATTACTGA
GCGGTAAAGGTGTGTTTTCAATTCATCGAACGAATGTGGACTTAAAGGTACGATAGGGAGCTTTTGCACTAGCTTTGTCATTGTGTCTTTGTGTTGATGT
GATGTGTCTGCTTCTCAGGACAAGTGGAAGAATATGCAAAGAATGAATCACATCAATTGCAAGCGAACCGCCGAAGTACAAAACTTGGCGCGTCACAAGC
GGTCTAGTGTAGCACATGCGACAAGAGTCGCTGCCGACCAATCAAGATCTGGAGGTGGTGTGGGCGAGTTGTCGTCAGTGGATAGTGTTGAGCTGAGAAC
TGACCCAAGCACTGCTATGGCTGTGGGCGCGATGGCTGCTACTGATCAACATGCGACTAGAGTTCGCTGCATTCCGGTTGAGGCAGACATATGTAATGCT
GTTGACCACGATAAAGGTGATATCCCCGATGCGACTGGATCGTTCCAGACACCACGCCAAGTTGTGTTACAGTTCGTATGCAACAGTAATTTTCCTGAGG
TACGTTTTCGCTACTCGCATCCGTGTTCTTATAATAGAAAGTCGGCACTCGTTTTTGATTATCACTGTCACTTGATGCAGATTACAAATGTCCGTGTCGA
CTTGGACACATGTAAGGATGTACCTACTTTAAAGAAGCTGCTACGCTCGAATATCTTGTCGGGTGCGCCACCGAACGAGGACGTCCAGATGATCGGCCTC
ACATCAAGACAGTTTTTTCAACATGACGAGCTTTTACTGCAATGCATGAGGATCAACAACGGCATAGACTTTTTTCTGGTGTTCGACGAAGCCGCAGCAG
TGTTTGTGTAAGCAAGTGAGTGGTTCTAAAACTTCGTGGCTCACTGTATTTTGTCCTAACAGACTTTGCGTCATCCATAGTTTGTGTGTGTGTAACAAGA
TGAGCCCGTCTCATGACCAAAATTACTAACATGAAAGTACGGCAGAAATAAGATAGGGGTGCAAGCTCTGGAGCTCGCTCTTTGATTTAGGTAATCCAGT
TCGGAGAACTGAATCAGGTTGCAAAACACTATACAACAGCAGCAGTCACTGAAGAAGGAGTATGATGCTATTAATGTCTAATTTAACCCAGAAGTGTCGA
TCACATGATAATATTCACTTTTGATCGATTTTAAGCCAATCACGTGCATGCATCACAATAGTGACGTAGCCAAAGCGTGACTTTGAATATACAGTCGTCC
CTCCATA