Description :
From Genome Similarity Track
Location :
Scaffold_897:1254- 3330
Transcript NameFunction/comments
Phyag_g8603myosin-like protein

Sequence
2076 bases(100 bases per row)
gacgtggacgacctgACCCAGCTcatcgagctggacgagacgaCGATCCTGTCGGCGCTCGAGACGCgcttcacgcagcagaagatcTACACCAATACGG
GGGCCATTCTGTTGGCGGTGAACCCGTTCCAGAAGATCCCCAATGTCTACAGCAAAGACACGATGGCGAATTATTTGCTGTCGTTCGAAGCAAGAAATTC
CTCCATGCGGAGCAAAGGCAGCGAACCCATGCCCCCACACATCTACCAAGTGGCTGGCGAGGCGTACAAGGCCATGATGTTGGGCCTGAATGGAGCTATG
AGCGACCAGAGTATCCTTGTGAGTGGAGAAAGTGGAAGTGGCAAGACGGAAAGTACCAAGTTCCTGATGGAGTATCTCGCCCAAGCTGGAGCTAATAATC
TAGCGGCGTCCGTGGCCGGGAAGAGCGTCGGAGGCATTGCTGCTAAAGTTTTGCAGACGAACATTCTGCTCGAGAGTTTTGGTAACGCGCGTACGCTGCG
CAACGACAACTCGAGTCGGTTCGGCAAGTTTATCAAACTGCACTTCACTAGTGGTGGCAGGCTTACAGGAGCTAGTATTCAGACCTATTTGCTCGAGAAG
GTGCGGCTTGTGTCGCAGTCTAAAGGTGAGCGGAATTATCACATCTTTTACGAAATGGCGATCGGCGCGGCACCCGCGGCGAGGAAGCGTTGGTTCTTGG
ACCCACCGAAGGGCCACTTGATGCCGCCTGGAGATCACGGAGAAGTGACGGACGCCACGCGCCAGTTCCTCCACTATCGGTTTTTGAACCAGAGCGAGTG
CTACGAGCGTCGGGATGGAGTTAAGGACTCGGACATGTTCCGACGAGTCATGGACGCTATGGACATTGTGGGGTTCACGCAGGCCGAGCGCGCAGGTATT
TTCGACATTTTGGCGGCGCTCATGCACATTGGTAATTTGTCCTTCGAGCACGATGAAAACAGCGACAGGTTAGGTCAGTCGATGGGACCTGGAGCCGGCA
AGTCGGACTTGGCACCTAGCTGCATTTGGTCGCGCGATGCCGCGGCTACGCTGATGGCTGTGGATGCTACGAAGTTGGAGCGTGCGCTGAGTGTGCGTCG
GATTCGTGCCGGTACTGACTTTGTGAGCATGAAGCTCTCCGCAGCCCAAGCTAACAATGCCCGCGACGCTCTCGCGAAGGCGTTGTATGGGCGGTTGTTT
GACTGGATGGTGAAAAAGATCAACCACTTCCTCAAGATGGACGACAGCCAGAAAGCTAAGGGTGGTCTCCACTTTATCGGGATTCTGGACATTTTCGGTT
TTGAGGTGTTCCCCAAGAATTCCTTCGAGCAGCTTTGCATCAACTTCGCCAATGagacgttgcagcagcagtttaACGACTACGTTTTCAAGGCGGAACA
GCGTGAGTACGAGTCGCAGGGCGTCGACTGGAAGTACATTGAGTTCTGCGATAACCAAGACTGTGTGAACCTAATTTCGCAGCGCCCAACTGGCATTCTC
TCGCTCATCGACGAGGAGTGTGTCATGCCGAAGGGAAGTGACACAACTTTGGCGTCCAAGCTTTACCGCGCCTGTGGAAGCCACTCTCGCTTCGAGGCGT
CTCGAATTCAGCGCGCACGTGGCCTCTTCACGATTGTACACTACGCAGGTCACGTAGAATACTCTTCAGATGGATTcctggagaagaacaaggacgTTCT
CCACCAAGAGGCTGTGGATATGCTAGTGTATTCCACGCGGGAAGACAGCTTTACTCGTACGCTGTGTGAGGGCCTTGGTGGCTCCCGTGACCGTGCGAAG
TCCTCACCGCGTCAACGTGCTCAAACCAGCAAGCACCGTGGTGCAAGTGTGGGCCTTCAGTTCAAGGAGCAGTTGACGACCTTGTTGGAGACGCTACAGC
AGACTAACCCGCACTATGTGCGCTGCCTCAAGCCGAATGAGTTGTGCAAGGCAGGCATTTACGAGCGCGAACGTGTATTGAACCAACTGCGCTGCAACGG
TGTGATGGAAGCGGTTCGCGTGGCCAGGGCAGGGTACCCGATCCGTTTACCGCACGATGAATTCGTCGCTCGCTAC