Description :
From Genome Similarity Track
Location :
Scaffold_3169:1254- 2625
Sequence
1371 bases(100 bases per row)
AGAACATGAAGGCAAGTTACACCCCGTACGGCTCCTCGGTCGTGTGCTCAAGGAAGCCGAGATGAACTACCATCCTGCTGAGAAGGCAGTTTTGGCGTTA
CTTCTGCTGTTGAAGATCTGTTACGTCCAGCTGGCAGGAAAGACGCTACATGTCCATACACGATTCTCGACGTTAGAGGGGGTGCACAAGTCGAAGATGA
TTTTCGATAGATTATAAGTGGTTTTGTACTGAATATCATGCGAAGCTCAGAAACAAATTATTTCTATACTTGAAGATTTGATACTCAGGTTTGCCATGTT
TGCAGGGCAAATTGAATCTACGACTAAGGAGAGAATACTTGTTCAAACTAACTGCTTCTGGCCTCTCTCTTCGGACGCGCGGTCCAGTTCGCCGTGCTGC
TTTCGCAGTGGTATGCAGCGCGTGAAGGAGAAAGATGTCGCCTTCGCGCAGCTACTGCAGTCAAGCATCACGAGCTTCGTCGACCTGGAAGACTCGCTCG
CGCCGGTGGCACCTCCAAACAAGGGTTCCCCGACTATTCAAATGGACCCCGCGTTGCTGTACGCCAGGCTTCCCCGTAATTACAGCGGATTCATCATGTC
TTTTGACGGATCAGCGAAGACAGAGAAGTACGGTGGCTACGGGAGTTGTTCATGGGTGCTGTGGAGCCTTCCTGAGTGGAAGATAGTGATTGCTGCAAAC
GCTTACCTCTCGGCCACCACGGTGAATGAAGCAGAATATACAGGTATGATAAACGGTGGCAAGGCTGCTATTGCGCACGGTGCCGAGAATTTAGTCATCG
TTGGTGACTCAAGCCTCGCGATTCAACAATCACTAGGGGGATCGCATGCAGGAAGGAGACTTTGCTAGCGCTGCTGAATACTCACAAGGAACTCGAGCCA
AGCTTCGATCAGTTAAATATCCTCACGCTGTACGAGAATACAACGCTGCCGCGGATTCGTTAGCCACTGAAGCGCTGGAATCAAAGGTCAGTCGTGTCAT
CTTGTCTGAAACTCGCAAGTCGGAATTGGCGTCGCTGAATCGCATCCAGGAAATGATCTACGAGCCGGATGAAGACTCGGTAAATGTTTCGTCACGAGGA
GCAGAGCGTCAAGCACATGTACTGTCAGGCAGCGAGTCTTCAAAGTGGAAAACTTTCGAAAATTTCGTGGTTGATTACAACTCACCAGAGTGTGATTATG
GTAATATGGCAGTGATGACTCGGCGACAGACGAAATCCAAGAAACGCGTCAGGTTTGCAGATGAAAACTCGGAGGAGGTCTCAAAAGCTCAAGTACAGCA
TGAAGATCGACGAGAGACGTCCACCGAAGATTCTATATGCGGCGAAGATTTGCCAGACCATCCTCACAAAA