Description :
From Genome Similarity Track
Location :
Scaffold_247:1254- 2539
Transcript NameFunction/comments
Sapdi_VS20SDRG_17287hypothetical protein

Sequence
1285 bases(100 bases per row)
CCCGACGACGTGTGCTGTAGCGCTGCTTGGATACGGTCTTCGTTGCGGCTAAAGACGTAGAGCGCCAGTGGCTTGGGCTTGAACCGAATGGTTTCTAGGA
CTGCGTCCAGGTCACTGTAGTAGACAATTGGCAGCAGCGGTCCAAAGAGCTCGTCGTCCATGAGCGCGCTCGCATTAAAGGCCGCCATGTCGTCCTTGTA
GTTGAAGAGAGACGGCGCCACAAAGCGCGTCGTGACATTGCAGTCGCCACCGTGGACGAGGTACGCTTTTTCCTTCTCGACGAGCGCCTTCATCTTGAAT
AGCTGCTGCACGTTGGCGACGCGGCCATAGTCGGCCGACGTCTCTGGCGTTGCGGTGAAGAGGTCCACGAGTGCCTTTTGGAGCGCTGCTACAAAAGCAT
CGCCGACCTGCAAGGACAGAATATGGCTACATACTCCATGGTGCAAATGTTCTACCTCGGTCGCCACGAAAATGTGGTCGGGACGGACACAGGTTTGGCC
ACCGTTGATAAAGGCGCCCCACGCCAACCGCTTGGCCGAGACCTAAACGACTTGGGGTTCGATAGCGTTTTTGACGCCGAGATCGTACCTCGAGGTCGGC
GGTCGCGTCGACGATGGCGGGTGTCTTGCCGCCAAGCTCGAGCACGATCGGTGTCAAGTGTTCGGCAGCGGCACGGGCCACCGCCTTGCCAATCACGGGA
CCTACACAGGTACTGAATGTAAAGCGTTGGCCATGGGACTGTACCGCCGGTGCAAAAGATCAAGTCGAAGCGCTGCGCCAAGACCTCTTTTGAGACGTCA
AGACTGCCGCGGACGGCGCGGACAATGTCGGTGTCGAGGTACGTGGCCATGAGGTCGGCGAGCACAGCGTTGGTGGCGTCCACCGACCCGTCGGCCGCGA
GACGTACGAGCGCGCAGTTGCCGGCGCTAATGGCCCCCACGAGCGGCAGCAGCGTCACGTGCAATGGGTAGTTCCACGTGCCAAAGATGCAGACGACGCC
GAGCGGCTCGGCGAGCGTTAAGGACCGGCCGGGAAAGCACGAGAGCGACGTCCATGTGTACTGCGGCGCGCTCCAGTCGTTTAGGTAGTCGAGATGCGTC
TGGATCTCGGCGAGGACGAGGCCAATCTCGGTGAGGAACGTCTCGTGCGCGGGCTTGTGCAGGTCGGTGTTGAGGGCCGCTGCGATCGGCGCCTCGTTGT
CGCGCAGCATGGCGCGGAGCTGCCGTAGGAGGGCCTTGCGCGTCTCGAGTGGCAGCGTCTTCTTGGCCGCAAACGAGTGGCGCAG